science-freaks.livejournal.com

Способ получения днк из молок лососевых рыб

Изобретение относится к области биохимии. Дезоксирибонуклеиновую кислоту (ДНК) выделяют из молок лососевых рыб. Размораживают и измельчают используемое сырье. Обрабатывают его водным раствором трипсина в течение 3 ч при 45°С при содержании компонентов (масс.%): молоки лососевых рыб - 40,0, трипсин - 0,02-0,22, вода - остальное. Центрифугируют полученный гидролизат и фильтруют его через бельтинг-ткань. Проводят лиофильное или распылительное высушивание. Выход готовой продукции из молок лососевых рыб составляет 10,0-18,0% от количества исходного сырья при содержании ДНК в целевом продукте не менее 62-65%. Изобретение позволяет увеличить выход получаемой ДНК в 2,2-2,4 раза. 1 табл., 5 пр.

 

Изобретение относится к технологии получения биологически активных веществ и может быть использовано в биотехнологии, а полученный продукт - в пищевой промышленности в качестве сырья при производстве биологически активных добавок к пище и специализированных пищевых продуктов, в парфюмерно-косметической промышленности в качестве биологически активной добавки в составе кремов, масок, лосьонов и других косметических средств, в научно-исследовательской практике.

Известен способ получения порошка натриевой соли дезоксирибонуклеиновой кислоты из молок рыб (1), предусматривающий гомогенизацию молок рыб, отделение осадка, обработку детергентом и концентрированным солевым раствором, воздействие ультразвуком с использованием при этом типового озвучивающего оборудования и условий, обеспечивающих получение ДНК с молекулярной массой от 0,6×105 до 1,5×105 Да, отделение белка и детергента либо фильтрованием через кизельгур и последующей тонкой фильтрацией, либо микрофильтрацией через фильтры с диаметром пор от 0,4 до 1,2 мкм, концентрирование фильтрата на ультрафильтрационном модуле при давлении 0,1-0,8 атм, его диафильтрацию и повторную обработку ультразвуком в условиях, обеспечивающих получение ДНК с молекулярной массой от 2,5×105 до 6,0×105 Да, осаждение ДНК из раствора этиловым спиртом и высушивание осадка до постоянного веса.

Описан также способ выделения дезоксирибонуклеиновых кислот (2), включающий адсорбцию дезоксирибонуклеиновых кислот на силикатном сорбенте в присутствии хаотропного агента, отделение и промывку сорбента с последующей элюцией нуклеиновых кислот с сорбента.

Известен способ получения нуклеопротеинового комплекса (3) который включает измельчение рыбных молок, обработку его 7-10%-ным раствором хлорида натрия в течение 2,5-3,5 часов при температуре кипения, отделение экстракта ДНК от плотной части, ультрафильтрацию с концентрированием экстракта до содержания сухих веществ 1,8-3%, сушку препарата, обработку его этанолом при 40-50°С, сушку на воздухе. Выход ДНК составляет 4,5-6,0%, содержание ДНК в препарате - не менее 65%.

Известен способ выделения натриевой соли ДНК из тканей животного происхождения (4). Способ включает измельчение и гомогенизацию в цитратно-солевом растворе (ССЦ), трехкратную промывку ядерного материала ССЦ. Затем отмытый ядерный материал помещают в реактор с ССЦ и 6% раствором додецилсульфата натрия в 45% этиловом спирте, нагревают до 60°С, добавляют равный объем 5М хлористого натрия, перемешивают, охлаждают до 12-16°С, обрабатывают реакционную массу ультразвуком, отделяют раствор ДНК от осадка балластных веществ фильтрацией реакционной массы через кизельгур на нутч-фильтре; концентрируют фильтрат на мембране с размером пор 0,45 мкм (потери ДНК при этом 3%), отмывают концентрат диафильтрацией на этой же мембране до отрицательной реакции на белок в пермеате.

Основным недостатком известных способов является то, что они предполагают использование этанола, являющегося социально опасным продуктом, требуют использования оборудования, в пожаро- и взрывобезопасном исполнении, а также наличия лицензии у производителя, на осуществление работ с применением этанола.

В качестве прототипа выбран способ производства натриевой соли дезоксирибонуклеиновой кислоты из животного сырья и установка для его осуществления (5), включающий измельчение животного сырья (молоки осетровых рыб, селезенка, эритроциты цыпленка и т.д.) и гомогенизацию в цитратно-солевом растворе, обработку гомогената детергентом и концентрированным раствором хлористого натрия при повышенной температуре, обработку реакционной смеси после предварительного формирования из нее слоя определенной толщины в течение 10-80 минут ультразвуком с частотой 8-35 кГц и интенсивностью 0,2-2,0 Вт/см2, смешивание «озвученной» массы с кизельгуром в соотношении соответственно 5:1-25:1 (объем/масс), отделение жидкой фазы фильтрованием и концентрирование барофильтрацией, осаждение Na-соли ДНК из концентрата этиловым спиртом, высушивание осадка при 20-60°С. Масштабирование процесса осуществляется благодаря созданию и использованию новой промышленной установки.

Недостатком известного способа является трудоемкость и продолжительность технологического процесса выделения ДНК, наличие двух этапов обработки ультразвуком в вертикальной герметичной ячейке при непрерывном прокачивании раствора перистальтическим насосом, что приводит к значительному снижению производительности процесса и усложнению его масштабирования, а также использование больших количеств необходимых реагентов, в том числе этилового спирта.

Целью заявленного изобретения является разработка способа получения ДНК из молок лососевых рыб, отличающегося увеличением выхода готовой продукции с более высоким содержанием ДНК, снижению стоимости продукта за счет уменьшения количества стадий технологического процесса и возможности его масштабирования за счет использования типового промышленного оборудования.

Для осуществления поставленной задачи производили размораживание сырья из молок лососевых рыб, его измельчение, гидролиз протеолитическим ферментом трипсином, отделение балластных белков и липидов методом центрифугирования, фильтрацию полученной смеси через бельтинг-ткань, лиофилизацию или распылительное высушивание раствора ДНК.

Полученный продукт характеризуется следующими показателями:

внешний вид - аморфный порошок;

цвет - от белого до светло-коричневого;

запах - свойственный данному продукту с рыбным оттенком;

массовая доля влаги, не более - 8%;

массовая доля основного вещества (ДНК), не менее - 65%.

Идентификацию состава получаемого готового продукта и содержание в нем ДНК определяли спектрофотометрическим методом.

Способ осуществляют следующим образом:

Пример 1. Получение ДНК при оптимальном соотношении исходного сырья и трипсина.

40 кг дефростированных молок лососевых рыб измельчают на коллоидной мельнице, обрабатывают водным раствором ферментного препарата трипсина при следующем соотношении компонентов (масс.%): молоки лососевых рыб: вода: трипсин, как 40:59,88:0,12 в течение 3 часов при 45°С.

Водородный показатель рН полученной реакционной смеси (измельченные молоки лососевых рыб и вода) соответствовал оптимуму действия трипсина (рН 8-9)

Полученный гидролизат, для удаления балластных белков и липидов, центрифугируют на проточной центрифуге (15000об./мин.), фильтруют через бельтинг-ткань и подвергают лиофильной или распылительной сушке.

Выход готовой продукции составляет 16,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65%.

Пример 2. Получение ДНК при минимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с минимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,96:0,04.

Выход готовой продукции составляет 14,0-16,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 64,0%.

Пример 3. Получение ДНК при максимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с максимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,8:0,2.

Выход готовой продукции составляет 17,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65,0%.

Пример 4. Получение ДНК при нижеминимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с нижеминимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,98:0,02.

Выход готовой продукции составляет 10,0-14,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 62,0%.

Пример 5. Получение ДНК при вышемаксимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с вышемаксимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,78:0,22.

Выход готовой продукции составляет 17,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65,0%.

Сравнительные данные по выходу готовой продукции и содержанию в ней основного вещества (ДНК) в зависимости от соотношения компонентов реакционной смеси (молоки лососевых рыб: вода: трипсин) приведены в таблице.

 

Начальная

Windows Commander

Far
WinNavigator
Frigate
Norton Commander
WinNC
Dos Navigator
Servant Salamander
Turbo Browser

Winamp, Skins, Plugins
Необходимые Утилиты
Текстовые редакторы
Юмор

File managers and best utilites

Способ выделения днк из молок осетровых рыб (его варианты). Днк рыб


ДНК древних лососевых рыб - Научная кунсткамера

ДНК древних лососевых рыб [Dec. 24th, 2009|10:39 am]

Научная кунсткамера

Читал РАН очищает воду от Петрика - сама по себе правильная статья, но в комментах напоролся на "БАД из ДНК древних лососевых рыб"Яндекс помог, в сообществе поиск не нашел. выношу.

http://www.domzdor.ru/biopark1.htmБиологически-активная добавка «Диэнай» благодаря своему уникальному составу обеспечивает поступление в организм человека фрагментов ДНК. Этот ценный пластический материал легко усваивается всеми клетками, особенно больными. В результате активируются механизмы естественного восстановления, и разрывается порочный круг хронического заболевания.

Из чего состоит «Диэнай»?

Биологически-активная добавка «Диэнай» содержит комплекс ферментов выделенных из Bacillus subtillis и фрагментированную ДНК из древних лососевых рыб.«Диэнай» - от создания до выпуска.

История создания препарата насчитывает более 20 лет биохимических и клинических исследований. Безопасность компонентов препарата подтверждена в Научно-исследовательском институте фармакологии, г. Томск, Тихоокеанском научно- исследовательском центре, г. Владивосток. Клиническая эффективность препарата «Диэнай» исследована в Научно-исследовательском институте лимфологии Сибирского отделения Российской Академии Медицинских наук, Новосибирской областной клинической больнице, Государственном институте усовершенствования врачей, г. Новокузнецк. В результате клинических исследований была подтверждена высокая эффективность препарата «Диэнай» в комплексном лечении различных заболеваний, в том числе: варикозной болезни, венозной недостаточности, ишемической болезни сердца, стенокардии, хронических гепатитов, полиартритов, сахарного диабета, анемий. В соответствии с Федеральным законом от 30 марта 1999 года № 52-ФЗ « О санитарно-эпидемиологическом благополучии населения» «Диэнай» прошел государственную регистрацию, внесён в государственный реестр и разрешен к производству и обороту на территории Российской Федерации (свидетельство о государственной регистрации № 77.99.23.3.У.7578.7.05 от 07.07.2005 г.) или офсайт:http://dnabiopark.ru/?tag=lososevyh (сайтс делан с типазащитой от типакопипаста. но мне и ручками набить не слабо. Каталог препаратов:Диэнай , Биосинол, Мидивирин , Бифизим, Веномакс, Верналис, ге-па, Нейростим. Таркус, ти-Сан, Хондромарин, Витакин-В. еще из яндекса:http://teya07.e-gloryon.com/Строительный материал в Хондромарине

Кроме минерально-белкового комплекса в состав Хондромарина входит сбалансированный комплекс, содержащий фрагментированную ДНК, очищенную стабилизированными протеазами. ДНК выделена из наиболее древних океанических рыб (лососевые). Генетическая память, заложенная в ДНК морских существ, поставлена на службу здоровья человека. ДНК является для человека дефицитным строительным материаломhttp://www.dolgolet.ru/bad/bad-dna-bifligh.html - BiFly Для питания и омоложения всех слоёв кожи мы разработали новую концепцию BiFly, которая основана на принципе встречных потоков. С помощью Axis ® -технологии активные вещества проникают через все биологические барьеры двумя потоками.

Первый поток - внешний (ДНК на Axis ® -полимере) Чтобы действующие вещества прошли в глубокие слои, ДНК соединили со специальным носителем Axis ® -полимером, который даёт возможность большим молекулам преодолевать биологические барьеры. Axis ® -полимер переносит в глубину кожи ДНК и воду. Этим достигается стойкий эффект увлажнения. В то же время ДНК древних океанических рыб обладают уникальной способностью активировать клетки кожи. В результате они начинают образовывать новый молодой коллаген. Глубокие слои кожи становятся упругими, а поверхностные слои эластичными и нежными. Это и есть молекулярный лифтинг. http://klubdolgoletie.ru/page12.php* ДИЭНАЙ содержит комплекс ферментов, разрушающих все белковые токсины в организме ( в том числе растворяет тромбы и холестериновые бляшки, убирает некротические массы после распада клеток и жизнедеятельности болезнетворной микрофлоры)* Фрагментированная ДНК (комплекс нуклеиновых кислот) обладает заживляющим действием, иммуномодулирующим и регенерирующим (восстановительным) эффектом. Характерно, что эти эффекты развиваются на уровне костного мозга, восстанавливая те ростки костного мозга, которые были подавлены.от крайнего я так понимаю будет расти хвостКакие теги поставить ?

UPD - Биосинол :) Состав Биосинола:высокоочищенный комплекс ферментов выделенных из Bacillus subtillis и фрагментированная ДНК из древних лососевых рыб, экстракт коры осины. UPD2 - там же далее в комментах чудесное:Б.В.Болотов еще в 1957 году ДОКАЗАЛ с помощью простого опыта, что основную часть углерода растения добывают не из СО2, а из.. атмосферного азота, осуществляя на свету ядерные превращения 2N2 -> 2CO -> 2C+О2. Для этого он наполнил закрытую прозрачную емкость смесью азота и кислорода (кислород нужен растению для дыхания), поместил в емкость растение и выставил ее на свет. Через некоторое время замеры показали, что количество кислорода в емкости растет, а азота - падает. Никто не спорит, что при наличии достаточного количества СО2 в воздухе, растения получают углерод из него (менее энергозатратный метод), но в обычных условиях, на природе, основным источником углерода для растения является атмосферный азот. Этим опытом была также доказана возможность низкотемпературной трансмутации элементов (иначе - холодный ядерный синтез), про невозможность чего официальная наука твердит уже несколько десятилетий. И сколько Болотов не предлагал своим оппонентам в присутствии экспертов проделать описанный выше опыт, никто не согласился. Ну еще бы: это ж сколько псевдоученых сразу лишатся научных степеней! Сколько диссертаций защищено на доказательствах "невозможности" холодного ядерного синтеза! Ну, а если результаты опыта Болотова подтвердятся, то, спрашивается: кто здесь шарлатан - Болотов или его оппоненты? А ведь опыт-то простой. И сейчас появляется все больше и больше работ, доказывающих возможность осуществления низкотемпературной трансмутации химических элементов.

Comments:

змеиное масло!

Загон про холодный синтез понравился.

[User Picture]From: inry_r2009-12-24 08:40 am (UTC)

Возможны небольшие побочные эффекты

(Link)

Фотография пациента, вылечившего хронический насморкА этот паиент избавился от хромоты в левой пятке
[User Picture]From: theindifferent2009-12-24 09:01 am (UTC)

Re: Возможны небольшие побочные эффекты

(Link)

Эксперименты с рыбонуклеиновой кислотой?

[User Picture]From: scif_yar2009-12-24 09:52 am (UTC)

Re: Возможны небольшие побочные эффекты

(Link)

с простой рыбой. в ней точно такое же ДНК :)

[User Picture]From: inry_r2009-12-24 10:48 am (UTC)

Re: Возможны небольшие побочные эффекты

(Link)

Извиняюсь, перепутал подписи к картинкам. А редактировать почему-то нельзя.

[User Picture]From: tigi2009-12-24 12:57 pm (UTC)

А вы удалите и перенапишите)

(Link)

Заодно картинку поменьше сделайте, пожалуйста, а то читать и пост, и комменты крайне трудно((( - все разнесло на полтора монитора...

>> 2N2 -> 2CO -> 2C+О2

Я трепещу, и все знакомые-физики тоже! Как всё просто -- берёт и превращается, а... азот в углерод и кислород -- раз! и готово.

капитан очевидность спешит сообщить нам, что для копипаста достаточно выключить javascript

там ещё много смешного

Верналис (Женский диэнай)Хронические воспалительные заболевания мочевыводящих путей (пиелонефриты, циститы, мочекаменная болезнь, простатиты)

Таркус (Мужской диэнай)

Показания к применению: биокоррекция при хронических воспалительных заболеваниях у мужчин, мужское бесплодие, импотенция, метаболический синдром, лечение сердечно-сосудистых заболеваний, сахарного диабета, заболеваний головного мозга и хронических заболеваний печени и почек, кишечника, гинекологических заболеваний, щитовидной железы, дыхательной и костно-мышечной системы.

и что такое "генетический дефолт", который лечат витамином В?гугление этого словосочетания даёт забавные результаты

с жаба скриптом да ..гугление гендефолта - это да ..http://uiec.org.ua/ru/endoekologiya-cheloveka/endoekologicheskmy-defolt-kletok-organizma.htmlИ еще одно. Установлено, что в результате термодинамических изменений, информационных взаимодействий клетки дистанционно информируют одна одну за счет их излучения, полевых потоков. В клетках разного возраста нарастает явление «генетического дефолта». Это явление в прошлом было довольно редким, а сегодня может охватывать до 15 и больше процентов клеток организма, когда кажется, что макромолекулярная генетическая конструкция клеток, которые делятся, нормальная (нет дефектов, которые известные классической генетике), тем не менее реализация этого геному информационно есть проблематической, поскольку информационную сферу внутри организм меняет. Генетические факторы не могут реализоваться нормально, и это явление в клетке вызывает не мутации, а «генетический дефолт». Именно «генетический дефолт» - это феномен эндоэкологии, который становится наиболее угрожающим в ХХІ столетии. Напомним, что за 70 лет жизни человека организмом вырабатывается и усваивается около семи тонн клеток крови, а вся клеточная масса составляет свыше 20 тонн. Речь идет о клетках генеративной системы. Клетки тканей, органов, особенно мозга, генеративного резерва оказались в экологически неадекватной среде, которая ведет к формированию новых уровней утомляемости и патологии.

Ученый подчеркивает, что минимальная доза не только радиации, химии, а и других факторов, в частности физических полей, может вызвать в клетке возбуждающий эффект и агрессивность, и методом тканевых культур он подтверждает этот феномен. Агрессиная возбужденная клетка .. выпрыгивает из организма и ползет до жертвы, потом ее зохавывает .. http://www.i-cheloveka.ru/kaznacheev/memories/subetto1/part2/Наконец, эта эпидемия приводит к тому, что человек вмешивается в генетические структуры биосферы, генетический дефолт угрожает всему биосферному чехлу, потому что макромолекулярные механизмы могут изменить свой ход…" (Казначеев В.П. Мысли о будущем. Интеллект, голографическая вселенная Козырева/ Отв. ред. д.м.н. А.В. Трофимов – Новосибирск: Сиб. науч. изд., 2008. – 192с.; нда..

http://massage-avatar.narod.ru/kaznaceev.htmlВладиль Казначеев,Академик РАМН,профессор. И, наконец, возможность, друзья мои, генетического дефолта. Может наступить такой период, и он уже наступает, когда у ребенка, вследствие воздействия экологических сред, которое мы до конца еще не знаем, наступает генетический дефолт - гены есть, но они не срабатывают.

Я бы сказал, что вы, Международный Коралловый Клуб, по-новому открываете слой палеоэкологии. Жизнь на Земле возникла 4,5 - 5 миллионов лет назад. Она накапливала в себе многие космические и земные качества, она упрятывала эти качества все глубже в более новые клеточные организмы и структуры...Я, отнюдь, не только пополняю дефициты кальция - это все, так сказать, само собой - я вношу память прошлых тысячелетий о чистоте и здоровье воды и жизни в океане. И клетки регенерируют! Это достояние Международного Кораллового Клуба - он РЕШАЕТ эти проблемы. ---http://massage-avatar.narod.ru/nutritio.htmlНо к великому сожалению,наша страна, стоит на одном из последних мест по применению БАД, всего 1% сознательного населения относятся к себе с вниманием и любовью.

Чтобы профилактика была эффективной, в её реализации кроме институтов государства должны принимать участие всё население в целом и каждый гражданин в отдельности.---http://massage-avatar.narod.ru/coral.htmlГидросель. Это удивительный секрет талых вод, горных потоков. Восемь капель на стакан любой жидкости - и вот ваша кровь становится более жидкой, наполняется энергией. Гидросель предотвратит раннее высыхание, а значит и раннее старение.

А удивительный секрет кораллов Санго? Один пакетик вы добавляете в 1,5 литра воды, выпиваете его - и вот уже ваша внутренняя среда становится сродни океану, щелочной, насыщенной минеральными веществами - возвращается память океанской воды.

Кстати, если вы забыли поменять фильтры, то скорость вашего автомобиля падает. А если вы забыли почистить свои собственные фильтры - кишечник, печень, почки - то путешествие по жизни перестает быть безопасным - мы накапливаем хронические болезни. Самая совершенная система очищения организма, программа Коло Вада Плюс, на натуральных растениях, поможет вам избавиться от паразитов и вывести яды.

Ржавчина - это признак раннего умирания автомобиля. А вы когда-нибудь задумывались над тем, что ежесекундно в каждой клетке вашего организма точно также происходят процессы окисления, и нам нужно мощное антикоррозийное средство. Микрогидрин - это самое совершенное достижение новых технологий, самый лучший антиоксидант. Он поможет нам.http://massage-avatar.narod.ru/hydracel.htmlГидросел» это препарат изготовленный по уникальной технологии. Он представляет собой жидкую форму нанокластеров (диоксид кремния, карбонат калия, сульфат магния, гидроксид калия) и подсолнечное масло.ДЛЯ ЧЕГО ПРИМЕНЯЕТСЯ ALКA-МINE?Измельченныи коралл очищает воду и улучшает ее биологические свойства. Микроэлементы из кораллового песка (около 70 жизненно важных элементов) переходят в раствор в ионной форме, способствуя лучшему усвоению питательных веществ и улучшению состояния при многих заболеваниях, в том числе хронических. Alka-Mine насыщает воду активным ионизированным кальцием и создает в организме щелочную среду, нормализуя кислотно-щелочной баланМикрогидрин - самый мощный антиоксидант из известных в настоящее время, нейтрализует и обезвреживает свободные радикалы, образующиеся в организме в процессе его жизнедеятельности. Каждая капсула Микрогидрина содержит тысячи нанокластеров - обогащенного водородом кремнезема, т.е. соединений кремнезема и атомов водорода, модифицированных таким образом, что на их внешней оболочке находится слабосвязанный дополнительный электрон.

Лютые агрессивные нанокластеры с активным водородом..

Ох. Как страшно жить... >_

(Deleted comment)

Интересно, существует ли такая страна\. где плотность идиотов выше, чем в России?

Номер примера Соотношение компонентов реакционной смеси (молоки лососевых рыб: вода: трипсин) Выход готовой продукции, %, не менее Содержание ДНК в готовой продукции, %, не менее
1. 40:59,88:0,12 16,0-18,0 65,0
2. 40:59,96:0,04 14,0-16,0 64,0
3. 40:59,8:0,20 17,0-18,0 65,0
4. 40:59,98:0,02 10,0-14,0 62,0
5. 40:59,78:0,22 17,0-18,0 65,0

Таким образом, увеличение добавления фермента трипсина свыше 0,22 масс.% не приводит к увеличению выхода готовой продукции и содержанию в ней основного вещества и, следовательно, экономически нецелесообразно.

Источники информации, приятные во внимание при экспертизе.

1. Патент RU №2041885 С1, C07H 21/04, C12N 15/10, 20.08.1995

2. Патент RU №2232768 С2, C07H 21/04, 20.07.2004

3. Патент RU №2122856 С1, A61K 35/60, 10.12.1998

4. Патент RU №2017496, A61K 35/60, C07H 21/04, 15.08.1998

5. Патент RU №2005724 C1, C07H 21/04, C12P 19/34, C12M 3/00,

15.01.1994 (прототип)

Способ получения ДНК из молок лососевых рыб, включающий размораживание, измельчение используемого сырья, обработку его водным раствором трипсина с последующим центрифугированием полученного гидролизата, фильтрацией через бельтинг-ткань, лиофильным или распылительным высушиванием, при этом обработку водным раствором трипсина проводят в течение 3 ч при 45°С при содержании компонентов, мас.%: молоки лососевых рыб 40,0, трипсин 0,02-0,22, вода остальное.

www.findpatent.ru

способ получения днк из молок лососевых рыб - патент РФ 2488634

Изобретение относится к области биохимии. Дезоксирибонуклеиновую кислоту (ДНК) выделяют из молок лососевых рыб. Размораживают и измельчают используемое сырье. Обрабатывают его водным раствором трипсина в течение 3 ч при 45°С при содержании компонентов (масс.%): молоки лососевых рыб - 40,0, трипсин - 0,02-0,22, вода - остальное. Центрифугируют полученный гидролизат и фильтруют его через бельтинг-ткань. Проводят лиофильное или распылительное высушивание. Выход готовой продукции из молок лососевых рыб составляет 10,0-18,0% от количества исходного сырья при содержании ДНК в целевом продукте не менее 62-65%. Изобретение позволяет увеличить выход получаемой ДНК в 2,2-2,4 раза. 1 табл., 5 пр.

Изобретение относится к технологии получения биологически активных веществ и может быть использовано в биотехнологии, а полученный продукт - в пищевой промышленности в качестве сырья при производстве биологически активных добавок к пище и специализированных пищевых продуктов, в парфюмерно-косметической промышленности в качестве биологически активной добавки в составе кремов, масок, лосьонов и других косметических средств, в научно-исследовательской практике.

Известен способ получения порошка натриевой соли дезоксирибонуклеиновой кислоты из молок рыб (1), предусматривающий гомогенизацию молок рыб, отделение осадка, обработку детергентом и концентрированным солевым раствором, воздействие ультразвуком с использованием при этом типового озвучивающего оборудования и условий, обеспечивающих получение ДНК с молекулярной массой от 0,6×105 до 1,5×105 Да, отделение белка и детергента либо фильтрованием через кизельгур и последующей тонкой фильтрацией, либо микрофильтрацией через фильтры с диаметром пор от 0,4 до 1,2 мкм, концентрирование фильтрата на ультрафильтрационном модуле при давлении 0,1-0,8 атм, его диафильтрацию и повторную обработку ультразвуком в условиях, обеспечивающих получение ДНК с молекулярной массой от 2,5×105 до 6,0×10 5 Да, осаждение ДНК из раствора этиловым спиртом и высушивание осадка до постоянного веса.

Описан также способ выделения дезоксирибонуклеиновых кислот (2), включающий адсорбцию дезоксирибонуклеиновых кислот на силикатном сорбенте в присутствии хаотропного агента, отделение и промывку сорбента с последующей элюцией нуклеиновых кислот с сорбента.

Известен способ получения нуклеопротеинового комплекса (3) который включает измельчение рыбных молок, обработку его 7-10%-ным раствором хлорида натрия в течение 2,5-3,5 часов при температуре кипения, отделение экстракта ДНК от плотной части, ультрафильтрацию с концентрированием экстракта до содержания сухих веществ 1,8-3%, сушку препарата, обработку его этанолом при 40-50°С, сушку на воздухе. Выход ДНК составляет 4,5-6,0%, содержание ДНК в препарате - не менее 65%.

Известен способ выделения натриевой соли ДНК из тканей животного происхождения (4). Способ включает измельчение и гомогенизацию в цитратно-солевом растворе (ССЦ), трехкратную промывку ядерного материала ССЦ. Затем отмытый ядерный материал помещают в реактор с ССЦ и 6% раствором додецилсульфата натрия в 45% этиловом спирте, нагревают до 60°С, добавляют равный объем 5М хлористого натрия, перемешивают, охлаждают до 12-16°С, обрабатывают реакционную массу ультразвуком, отделяют раствор ДНК от осадка балластных веществ фильтрацией реакционной массы через кизельгур на нутч-фильтре; концентрируют фильтрат на мембране с размером пор 0,45 мкм (потери ДНК при этом 3%), отмывают концентрат диафильтрацией на этой же мембране до отрицательной реакции на белок в пермеате.

Основным недостатком известных способов является то, что они предполагают использование этанола, являющегося социально опасным продуктом, требуют использования оборудования, в пожаро- и взрывобезопасном исполнении, а также наличия лицензии у производителя, на осуществление работ с применением этанола.

В качестве прототипа выбран способ производства натриевой соли дезоксирибонуклеиновой кислоты из животного сырья и установка для его осуществления (5), включающий измельчение животного сырья (молоки осетровых рыб, селезенка, эритроциты цыпленка и т.д.) и гомогенизацию в цитратно-солевом растворе, обработку гомогената детергентом и концентрированным раствором хлористого натрия при повышенной температуре, обработку реакционной смеси после предварительного формирования из нее слоя определенной толщины в течение 10-80 минут ультразвуком с частотой 8-35 кГц и интенсивностью 0,2-2,0 Вт/см2, смешивание «озвученной» массы с кизельгуром в соотношении соответственно 5:1-25:1 (объем/масс), отделение жидкой фазы фильтрованием и концентрирование барофильтрацией, осаждение Na-соли ДНК из концентрата этиловым спиртом, высушивание осадка при 20-60°С. Масштабирование процесса осуществляется благодаря созданию и использованию новой промышленной установки.

Недостатком известного способа является трудоемкость и продолжительность технологического процесса выделения ДНК, наличие двух этапов обработки ультразвуком в вертикальной герметичной ячейке при непрерывном прокачивании раствора перистальтическим насосом, что приводит к значительному снижению производительности процесса и усложнению его масштабирования, а также использование больших количеств необходимых реагентов, в том числе этилового спирта.

Целью заявленного изобретения является разработка способа получения ДНК из молок лососевых рыб, отличающегося увеличением выхода готовой продукции с более высоким содержанием ДНК, снижению стоимости продукта за счет уменьшения количества стадий технологического процесса и возможности его масштабирования за счет использования типового промышленного оборудования.

Для осуществления поставленной задачи производили размораживание сырья из молок лососевых рыб, его измельчение, гидролиз протеолитическим ферментом трипсином, отделение балластных белков и липидов методом центрифугирования, фильтрацию полученной смеси через бельтинг-ткань, лиофилизацию или распылительное высушивание раствора ДНК.

Полученный продукт характеризуется следующими показателями:

внешний вид - аморфный порошок;

цвет - от белого до светло-коричневого;

запах - свойственный данному продукту с рыбным оттенком;

массовая доля влаги, не более - 8%;

массовая доля основного вещества (ДНК), не менее - 65%.

Идентификацию состава получаемого готового продукта и содержание в нем ДНК определяли спектрофотометрическим методом.

Способ осуществляют следующим образом:

Пример 1. Получение ДНК при оптимальном соотношении исходного сырья и трипсина.

40 кг дефростированных молок лососевых рыб измельчают на коллоидной мельнице, обрабатывают водным раствором ферментного препарата трипсина при следующем соотношении компонентов (масс.%): молоки лососевых рыб: вода: трипсин, как 40:59,88:0,12 в течение 3 часов при 45°С.

Водородный показатель рН полученной реакционной смеси (измельченные молоки лососевых рыб и вода) соответствовал оптимуму действия трипсина (рН 8-9)

Полученный гидролизат, для удаления балластных белков и липидов, центрифугируют на проточной центрифуге (15000об./мин.), фильтруют через бельтинг-ткань и подвергают лиофильной или распылительной сушке.

Выход готовой продукции составляет 16,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65%.

Пример 2. Получение ДНК при минимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с минимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,96:0,04.

Выход готовой продукции составляет 14,0-16,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 64,0%.

Пример 3. Получение ДНК при максимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с максимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,8:0,2.

Выход готовой продукции составляет 17,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65,0%.

Пример 4. Получение ДНК при нижеминимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с нижеминимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,98:0,02.

Выход готовой продукции составляет 10,0-14,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 62,0%.

Пример 5. Получение ДНК при вышемаксимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с вышемаксимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,78:0,22.

Выход готовой продукции составляет 17,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65,0%.

Сравнительные данные по выходу готовой продукции и содержанию в ней основного вещества (ДНК) в зависимости от соотношения компонентов реакционной смеси (молоки лососевых рыб: вода: трипсин) приведены в таблице.

Номер примера Соотношение компонентов реакционной смеси (молоки лососевых рыб: вода: трипсин) Выход готовой продукции, %, не менее Содержание ДНК в готовой продукции, %, не менее
1. 40:59,88:0,1216,0-18,0 65,0
2.40:59,96:0,04 14,0-16,0 64,0
3. 40:59,8:0,20 17,0-18,065,0
4. 40:59,98:0,0210,0-14,0 62,0
5.40:59,78:0,22 17,0-18,0 65,0

Таким образом, увеличение добавления фермента трипсина свыше 0,22 масс.% не приводит к увеличению выхода готовой продукции и содержанию в ней основного вещества и, следовательно, экономически нецелесообразно.

Источники информации, приятные во внимание при экспертизе.

1. Патент RU № 2041885 С1, C07H 21/04, C12N 15/10, 20.08.1995

2. Патент RU № 2232768 С2, C07H 21/04, 20.07.2004

3. Патент RU № 2122856 С1, A61K 35/60, 10.12.1998

4. Патент RU № 2017496, A61K 35/60, C07H 21/04, 15.08.1998

5. Патент RU № 2005724 C1, C07H 21/04, C12P 19/34, C12M 3/00,

15.01.1994 (прототип)

ФОРМУЛА ИЗОБРЕТЕНИЯ

Способ получения ДНК из молок лососевых рыб, включающий размораживание, измельчение используемого сырья, обработку его водным раствором трипсина с последующим центрифугированием полученного гидролизата, фильтрацией через бельтинг-ткань, лиофильным или распылительным высушиванием, при этом обработку водным раствором трипсина проводят в течение 3 ч при 45°С при содержании компонентов, мас.%: молоки лососевых рыб 40,0, трипсин 0,02-0,22, вода остальное.

www.freepatent.ru

Способ получения натриевой соли днк из молок рыб

 

Изобретение относится к способу получения натриевой соли ДНК из зрелых молок рыб и может найти применение при получении иммуномодуляторов на основе нуклеиновых кислот в фармацевтической промышленности. Способ заключается в том, что гомогенизируют зрелые молоки рыб, к гомогенату добавляют комплекс ферментов, выделенный из гепатопанкреаса Камчатского краба, обладающий протеолитической, липазной и нуклеазной активностями, и натриевую соль этилендиаминотетрауксусной кислоты до конечной концентрации ее в реакционной смеси 3-30 мМ, инкубируют реакционную смесь, после чего добавляют хлористый натрий до концентрации 20-100 г/л в реакционной смеси, нагревают до 56-60oC, выдерживают при этой температуре, охлаждают до 2-8oC и отделяют осадок центрифугированием или нутч-фильтрацией. Способ позволяет получать ДНК различной молекулярной массы с содержанием белка 0,7 и 0,1%. 4 з.п. ф-лы, 3 ил.

Изобретение относится к способу получения натриевой соли ДНК из зрелых молок рыб и может найти применение при получении иммуномодуляторов на основе нуклеиновой кислоты в фармацевтической промышленности.

В настоящее время помимо широкого использования препаратов дезоксирибонуклеиновых кислот в научных целях для изучения структурно-функциональной организации генетического аппарата клетки активно разрабатываются схемы их применения в качестве лечебных средств при раковых заболеваниях, лучевой болезни, диабете и других патологических состояниях организма, при которых необходима его иммунокоррекция либо иммуномодуляция. Хорошо зарекомендовавшим себя источником выделения дезоксирибонуклеиновых кислот (ДНК) в промышленных целях являются зрелые молоки рыб, имеющие ряд преимуществ перед сырьем иного происхождения, таким, например, как органы и ткани животных либо растений, биомасса микроорганизмов и т.п. К основным преимуществам рыбных молок, как сырья, могут быть отнесены: наиболее высокое содержание ДНК по сравнению с другими источниками, относительно низкое содержание рибонуклеиновых кислот (РНК) и других примесей, а также дешевизна и доступность молок, являющихся отходами рыбной промышленности. Известные способы получения ДНК предусматривают выделение на первом этапе дезоксинуклеопротеида (ДНП), из которого на второй стадии удаляют белок с помощью детергентов, катионитов или протеазами. Известен способ получения ДНК (авт. свид. СССР N 1373709, 1988, МКИ С 07 Н 21/04), cогласно которому ткани животных гомогенизируют и затем центрифугируют. Осаждающийся хроматин отмывают от рибонуклеопротеидов не менее 6 раз, каждый раз отделяя его центрифугированием и проводя весь процесс при 4oC. Отмытый ДНП суспендируют в солевом буферном растворе с 0,15 М хлористого натрия, доводят концентрацию соли до 2 М, после чего добавляют катионит и проводят диализ полученной суспензии ДНП с катионитом против физраствора при постоянном перемешивании в течение 12 ч при 4oC. Диализованный препарат ДНК центрифугируют, в надосадочной жидкости остается раствор ДНК концентрацией не более 0,2 мг/мл и содержанием белка менее 1% Недостатками данного способа являются необходимость проведения работы при низких температурах (сложность технологии), возможность получения только разбавленных растворов ДНК и небольших ее количеств. Способ пригоден только для использования в лабораторной практике. Известен способ (авт. свид. СССР N 496279, 1975, МКИ С 07 Н 21/04), по которому удаляют белки из ДНП экстракцией хлороформом в присутствии бентонита при 15-20oC и интенсивном перемешивании. После центрифугирования суспензии ДНК из надосадочной жидкости осаждают этиловым спиртом. В этом случае продемонстрирована авторами возможность получения нескольких десятков грамм ДНК с содержанием основного вещества в конечном продукте 80-85% Недостатками способа являются использование экологически вредного соединения хлороформа, высокая стоимость процесса, а также его трудоемкость. Известен способ (авт. свид. СССР N 644484, 1979, МКИ С 07 Н 21/04), согласно которому депротеинизацию отмытого ДНП также проводят экстракцией органическими растворителями смесью хлороформа с изоамиловым спиртом. После отделения осадка центрифугированием ДНК осаждают из надосадочной жидкости 2 объемами охлажденного этилового спирта. К сожалению, авторы не указывают степень чистоты получаемой ими ДНК. Недостатком данного способа является использование экологически вредного соединения хлороформа. Известен способ получения ДНК (авт. свид. СССР N 487897, 1975, МКИ С 07 G 7/026), согласно которому молоки рыб гомогенизируют в холодном цитратно-солевом растворе, центрифугируют и осадок вновь гомогенизируют в цитратно-солевом растворе, затем при перемешивании добавляют 6%-ный раствор додецилсульфата натрия (ДНС) до конечной концентрации ДСН 1% и, не прекpащая перемешивания, нагревают раствор до 60oC и выдерживают при этой температуре 1,5 ч. После чего добавляют вновь цитратно-солевую смесь до конечной концентрации хлористого натрия 16% и концентрации трехзамещенного цитрата натрия 2,6% и перемешивают смесь еще 1,5 ч при 60oC, по окончании чего смесь охлаждают до 2-4oC, смешивают с кизельгуром и элюируют ДНК с него цитратно-солевым раствором. Раствор ДНК отделяют от кизельгура фильтрацией через слой бальтинга и фильтровальной бумаги на нутч-фильтре. ДНК из раствора осаждают холодным 96% -ным этиловым спиртом. ДНК, полученная данным способом, содержит не более 1,5% белка, обладает значительным гиперхромным эффектом (41%). Недостатком данного способа является расход значительных количеств растворов: для получения 1 г ДНК требуется около 12 л цитратно-солевого раствора, что требует использования больших емкостей реакционных сосудов. Известен способ получения ДНК (пат. РФ N 2017496, 1994, МКИ С 07 Н 21/04), согласно которому молоки гомогенизируют в цитратно-солевом растворе, осадок после центрифугирования трижды промывают этим же раствором, отмытый осадок суспендируют в цитратно-солевом растворе с 6% додецилсульфата натрия в 45% -ном этиловом спирте, нагревают до 60oC, после чего добавляют равный объем 5 М хлористого натрия, перемешивают и охлаждают до 12-16oC. Полученную реакционную массу обрабатывают ультразвуком и осадок отделяют фильтрацией суспензии через кизельгур. ДНК из фильтрата отделяют на мембране с размером пор 0,45 мкм и промывают на этой же мембране до отрицательной пробы на белок в промывочных растворах. Недостатком данного способа является использование в ходе получения ДНК ультразвука, что неизбежно влечет применение в технологии мощных ультразвуковых машин, что удорожает получение субстанции и усложняет технологию. Известен способ (авт. свид. СССР N 652187, 1979, МКИ С 07 Н 21/04), по которому гомогенат молок рыб в 0,15 М хлористом натрии центрифугируют и многократно промывают полученный осадок солевым буфером до отрицательной пробы на белок в промывочной жидкости, после чего осадок ресуспендируют в растворе протеолитического фермента (обычно трипсина или проназы) и инкубируют при 370oC в течение 18 ч. Далее клетки лизируют 0,5%-ным раствором додецилсульфата натрия и из полученной вязкой массы удаляют белки экстракцией фенолом. После центрифугирования к надосадочной жидкости добавляют хлористый натрий до конечной концентрации 3 М и экстрагируют равным объемом смеси хлороформа с изоамиловым спиртом. После центрифугирования из надосадочной жидкости осаждают ДНК равным объемом концентрированного этилового спирта. Для получения ДНК повышенной чистоты ее обрабатывают РНК-азой и затем трипсином для удаления примеси РНК и белка. Затем полученную ДНК несколько раз переосаждают и проводят одну-две депротеинизации хлороформом, после чего ее осаждают концентрированным этанолом, промывают несколько раз 70%-ным этиловым спиртом. Данным способом удается получить ДНК высокой степени чистоты (содержание белка около 1% отсутствие примеси полисахаридов, примеси РНК). Однако к недостаткам метода следует отнести многостадийность и использование органических растворителей для депротеинизации ДНП, которые являются экологически вредными и достаточно дорогими, что делает процесс более дорогостоящим и сложным. Наиболее близким техническим решением является способ получения ДНК, в котором удаление белка из ДНП ведут с помощью протосубтилина протеазы, выделенной из Bacillus Subtilis (авт. свид. СССР N 780444, 1985, МКИ С 07 D 13/06). Гомогенат молок лосося разбавляют равным объемом 0,15 М NaCl, центрифугируют, осадок трижды промывают 0,15 М NaCl, затем этанолом. Полученный ДНП суспендируют в солевом буфере, нагревают суспензию до 35oC, добавляют протосубтилин до 1,2 ед. акт/мл и выдерживают 30 мин при слабом перемешивании. После центрифугирования реакционной смеси надосадочную жидкость смешивают с равным объемом этилового спирта и извлекают пряди ДНК. Однако существенным недостатком известного способа является получение с использованием протосубтилина ДНК с высоким содержанием белка (2,4%), которую нельзя использовать без дополнительной очистки для получения инъекционных или иных лекарственных препаратов, в которых содержание белка не должно превышать 1,5% Другим недостатком является то, что согласно описанному способу удается получать только высокомолекулярную ДНК, которая медленно растворяется, образует очень вязкие растворы и также не годится без дополнительной фрагментации для получения на ее основе лекарственных препаратов. Задачей изобретения является разработка такого ферментативного способа получения ДНК из молок половозрелых рыб, который бы позволял без дополнительной очистки и усложнения технологической схемы получать ДНК с содержанием белка не более 1,5% и одновременно позволял бы получать заданный размер нуклеиновых кислот, не прибегая к дополнительным техническим средствам, например использованию ультразвуковых установок. Поставленная задача решается тем, что предлагается способ получения натриевой соли ДНК из молок рыб путем их гомогенизации и удаления белков из комплекса с ДНК с помощью обработки ферментным препаратом, выделенным из гепатопанкреаса Камчатского краба, обладающий протеолитической, липазной и нуклеазной активностями. Другим важным приемом является добавление в реакционную смесь натриевой соли ЭДТА с последующей инкубацией. Молекулярную массу получаемой натриевой соли ДНК можно регулировать, варьируя количество добавленной ЭДТА. Для получения низкомолекулярной ДНК добавляют ЭДТА до концентрации 3-10 мМ. Для получения ДНК средних размеров добавляют ЭДТА до концентрации 10-20 мМ. Для получения высокомолекулярной ДНК добавляют ЭДТА до концентрации 20-30 мМ. Кроме того, установлено, что повторная инкубация реакционной смеси в присутствии хлористого натрия в конечной концентрации 20-100 г/л позволяет получить препарат ДНК с меньшим содержанием белка. Для получения высокоочищенной ДНК с содержанием белка менее 0,1% раствор ДНК пропускают через колонку с аминообменником модифицированным силикагелем (полисил СА-500, 20-30 мкм), промывают колонку 0,5-1 М раствором хлористого натрия и элюируют высокочистую ДНК 2 М раствором NaCl. В сравнении с известными способами более высокая степень чистоты ДНК достигается за счет добавления вместо конкретной протеазы протосубтилина смеси протеаз из гепатопанкреаса камчатского краба и дополнительной стадией прогреванием реакционной смеси при 56-60oC после гидролиза в солевом растворе. После этих обработок содержание белка в препарате ДНК не превышает 0,7% Следует также добавить, что для получения ДНК, как лекарственной субстанции, ее необходимо фрагментировать, в частности, для этих целей и повышения выхода ДНК до 3% используется ультразвук. В заявляемом способе использование ультразвука не требуется, поскольку в комплексе ферментов из камчатского краба присутствуют и ДНКазы и РНКазы, поэтому только регуляцией количества добавляемого ЭДТА можно добиться получения препарата ДНК с заданным распределением молекулярных весов фрагментов, а выход ДНК из молок рыб также возрастает с 3% до 4-7,5% в предлагаемом способе. На фиг.1 изображена схема получения препарата ДНК по заявляемому способу, где (А) дополнительные стадии, необходимые для получения высокоочищенной ДНК с содержанием белка менее 0,1% на фиг.2 спектр поглощения полученных по заявляемому способу образцов ДНК в УФ-области; на фиг.3 электрофорегpамма образцов ДНК, выделенных согласно заявляемому способу при различном содержании ЭДТА в реакционной смеси, 1-22 маркеры молекулярного веса. Стрелками отмечено положение самого большого фрагмента (1300 пар оснований) и самого маленького (50 пар оснований). 1, 22 маркеры молекулярного веса, Bspl гидролизат плазмидной ДНК pQPR, стрелками отмечено положение самого большого фрагмента (1300 пар оснований) и самого маленького (50 пар оснований). 2, 7, 12, 17 ДНК, полученная согласно заявляемого способа при концентрации ЭДТА 5 мМ. 3, 8, 13, 18 ДНК, полученная при концентрации ЭДТА 10 мМ. 4, 9, 14, 19 ДНК, полученная при концентрации ЭДТА 15 мМ. 5, 10, 15, 20 ДНК, полученная при содержании ЭДТА в реакционной смеси 20 мМ. 6, 11, 16, 21 образцы ДНК, полученные согласно [5] Пример 1. Схема получения ДНК представлена на фиг.1. 1 кг замороженных молок лосося промывают питьевой водопроводной водой и затем ополаскивают дистиллированной водой, гомогенизируют в 900 мл 0,15 М раствора хлористого натрия в течение 10-15 мин при максимальных оборотах ножа гомогенизатора. К гомогенату добавляют 100 мл 0,40 М раствора динатриевой соли ЭДТА (рН 8,0) до конечной концентрации 20 мМ и гомогенизируют дополнительно 5 мин. К полученной вязкой массе добавляют 1 г комплекса ферментов, полученного из гепатопанкреаса Камчатского краба, и перемешивают массу гомогенизацией в течение 2 мин. Далее смесь инкубируют при 37oC в течение 16 ч. К полученной гидролитической массе присыпают 20-100 г/л хлористого натрия, нагревают при перемешивании до 56oC и выдерживают при этом температуре. Далее реакционную массу охлаждают и отделяют раствор ДНК от осадка центрифугированием либо фильтрацией на нутч-фильтре. К охлажденному раствору при перемешивании добавляют два объема охлажденного этилового спирта и формируют осадок ДНК в течение не менее 2 ч. Полученный осадок отделяют на нутч-фильтре, промывают 300 мл 70% этилового спирта, подсушивают на воздухе и растворяют в 800-1000 мл 0,5 М раствора хлористого натрия. Полученный раствор вновь прогревают и осаждают ДЕК этиловым спиртом. Сформированный осадок отделяют фильтрацией на нутч-фильтре, последовательно промывают 300 мл 70%-ного, а затем 96%-ного этилового спирта и сушат при 30-50oC в вакууме водоструйного насоса. Выход натриевой соли ДНК в зависимости от ее содержания в исходном сырье 40-75 г. Cпектр поглощения полученной по данной схеме ДНК представлен на фиг.2, электрофореграмма на фиг.3. Белок определяли по стандартному методу Бредфорда, используя в качестве стандарта раствор человеческого сывороточного альбумина. Выход ДНК рассчитывали по поглощению при 260 нм, используя коэффициент пересчета 1 о.е.50 мкг. Гиперхромизм ДНК (в) определяли, сравнивая оптическую плотность при 260 нм раствора ДНК до и после гидролиза 5% хлорной кислотой при 100oC в течение 20 мин. Содержание белка в образцах ДНК, полученных по заявляемому способу, существенно ниже, чем у известных способов. Кроме этого, выход ДНК также значительно выше (4-7,5% вместо 3, как в известных способах). Получаемая по нашему способу ДНК имеет двухцепочечную структуру, о чем свидетельствует высокое значение гиперхромного эффекта (33-42%). Наличие в ферментном препарате нуклеазных активностей приводит к получению фрагментированной ДНК, с размером фрагментов от 50 до 1300 пар оснований. Максимум распределения ДНК по фрагментам смещается в сторону более протяженных фрагментов при повышении концентрации ЭДТА в реакционной смеси (фиг.3). Пример 2. 1 кг замороженных молок лосося промывают питьевой водопроводной водой и затем ополаскивают дистиллированной водой, гомогенизируют в 950 мл 0,15 М раствора хлористого натрия в течение 10-15 мин при максимальных оборотах ножа гомогенизатора. К гомогенату добавляют 50 мл 0,40 М раствора динатриевой соли ЭДТА (рН 8,0) до конечной концентрации 10 мМ и гомогенизируют дополнительно 5 мин. Далее из полученного гомогената выделяют низкомолекулярную нативную ДНК согласно примера 1. Пример 3. 1 кг замороженных молок лосося промывают питьевой водопроводной водой и затем ополаскивают дистиллированной водой, гомогенизируют в 850 мл 0,15 М раствора хлористого натрия в течение 10-15 мин при максимальных оборотах ножа гомогенизатора. К гомогенату добавляют 150 мл 0,40 М раствора динатриевой соли ЭДТА (рН 8,0) до конечной концентрации 30 мМ и гомогенизируют дополнительно 5 мин. Далее из полученного гомогената выделяют высокомолекулярную нативную ДНК согласно примера 1. Пример 4. ДНК, полученную согласно примеров 1-3, растворяют в физиологическом растворе (концентрация 10 мг/мл) и пропускают через колонку с модифицированным силикагелем (Полисил СА-500, 20-30 мкм). После нанесения колонку промывают и элюируют ДНК 2 М NaCl. Анализ относительного содержания белка в различных фракциях показал, что высокочистая ДНК (содержание белка менее 0,1%) элюируется 2 М NaCl. Промышленная применимость. Изобретение может быть использовано в медицине и фармацевтической промышленности, а также при приготовлении косметических препаратов.

Формула изобретения

1. Способ получения натриевой соли ДНК из молок рыб путем гомогенизации сырья в растворе хлористого натрия, инкубации гомогената в присутствии протеолитического фермента с последующим отделением и очисткой целевого продукта, отличающийся тем, что гомогенат обрабатывают раствором натриевой соли ЭДТА до конечной концентрации в реакционной смеси 3 30 мМ, инкубируют в присутствии комплекса протеолитических ферментов при 20 40oС, далее добавляют хлористый натрий до конечной концентрации 20 100 г/л в реакционной смеси, а перед отделением целевого продукта реакционную смесь охлаждают до 2 - 8oС. 2. Способ по п. 1, отличающийся тем, что для получения низкомолекулярной ДНК добавляют ЭДТА до конечной концентрации в реакционной смеси 3 10 мМ. 3. Способ по п. 1, отличающийся тем, что для получения ДНК средних размеров добавляют ЭДТА до конечной концентрации в реакционной смеси 10 20 мМ. 4. Способ по п.1, отличающийся тем, что для получения высокомолекулярной ДНК добавляют ЭДТА до конечной концентрации в реакционной смеси 20 30 мМ. 5. Способ по пп. 1 4, отличающийся тем, что для получения высокоочищенной ДНК с содержанием белка менее 0,1 процента раствор ДНК пропускают через колонку с анионообменником.

РИСУНКИ

Рисунок 1, Рисунок 2, Рисунок 3

www.findpatent.ru

СПОСОБ ПОЛУЧЕНИЯ ДНК ИЗ МОЛОК ЛОСОСЕВЫХ РЫБ

Изобретение относится к технологии получения биологически активных веществ и может быть использовано в биотехнологии, а полученный продукт - в пищевой промышленности в качестве сырья при производстве биологически активных добавок к пище и специализированных пищевых продуктов, в парфюмерно-косметической промышленности в качестве биологически активной добавки в составе кремов, масок, лосьонов и других косметических средств, в научно-исследовательской практике.

Известен способ получения порошка натриевой соли дезоксирибонуклеиновой кислоты из молок рыб (1), предусматривающий гомогенизацию молок рыб, отделение осадка, обработку детергентом и концентрированным солевым раствором, воздействие ультразвуком с использованием при этом типового озвучивающего оборудования и условий, обеспечивающих получение ДНК с молекулярной массой от 0,6×105 до 1,5×105 Да, отделение белка и детергента либо фильтрованием через кизельгур и последующей тонкой фильтрацией, либо микрофильтрацией через фильтры с диаметром пор от 0,4 до 1,2 мкм, концентрирование фильтрата на ультрафильтрационном модуле при давлении 0,1-0,8 атм, его диафильтрацию и повторную обработку ультразвуком в условиях, обеспечивающих получение ДНК с молекулярной массой от 2,5×105 до 6,0×105 Да, осаждение ДНК из раствора этиловым спиртом и высушивание осадка до постоянного веса.

Описан также способ выделения дезоксирибонуклеиновых кислот (2), включающий адсорбцию дезоксирибонуклеиновых кислот на силикатном сорбенте в присутствии хаотропного агента, отделение и промывку сорбента с последующей элюцией нуклеиновых кислот с сорбента.

Известен способ получения нуклеопротеинового комплекса (3) который включает измельчение рыбных молок, обработку его 7-10%-ным раствором хлорида натрия в течение 2,5-3,5 часов при температуре кипения, отделение экстракта ДНК от плотной части, ультрафильтрацию с концентрированием экстракта до содержания сухих веществ 1,8-3%, сушку препарата, обработку его этанолом при 40-50°С, сушку на воздухе. Выход ДНК составляет 4,5-6,0%, содержание ДНК в препарате - не менее 65%.

Известен способ выделения натриевой соли ДНК из тканей животного происхождения (4). Способ включает измельчение и гомогенизацию в цитратно-солевом растворе (ССЦ), трехкратную промывку ядерного материала ССЦ. Затем отмытый ядерный материал помещают в реактор с ССЦ и 6% раствором додецилсульфата натрия в 45% этиловом спирте, нагревают до 60°С, добавляют равный объем 5М хлористого натрия, перемешивают, охлаждают до 12-16°С, обрабатывают реакционную массу ультразвуком, отделяют раствор ДНК от осадка балластных веществ фильтрацией реакционной массы через кизельгур на нутч-фильтре; концентрируют фильтрат на мембране с размером пор 0,45 мкм (потери ДНК при этом 3%), отмывают концентрат диафильтрацией на этой же мембране до отрицательной реакции на белок в пермеате.

Основным недостатком известных способов является то, что они предполагают использование этанола, являющегося социально опасным продуктом, требуют использования оборудования, в пожаро- и взрывобезопасном исполнении, а также наличия лицензии у производителя, на осуществление работ с применением этанола.

В качестве прототипа выбран способ производства натриевой соли дезоксирибонуклеиновой кислоты из животного сырья и установка для его осуществления (5), включающий измельчение животного сырья (молоки осетровых рыб, селезенка, эритроциты цыпленка и т.д.) и гомогенизацию в цитратно-солевом растворе, обработку гомогената детергентом и концентрированным раствором хлористого натрия при повышенной температуре, обработку реакционной смеси после предварительного формирования из нее слоя определенной толщины в течение 10-80 минут ультразвуком с частотой 8-35 кГц и интенсивностью 0,2-2,0 Вт/см2, смешивание «озвученной» массы с кизельгуром в соотношении соответственно 5:1-25:1 (объем/масс), отделение жидкой фазы фильтрованием и концентрирование барофильтрацией, осаждение Na-соли ДНК из концентрата этиловым спиртом, высушивание осадка при 20-60°С. Масштабирование процесса осуществляется благодаря созданию и использованию новой промышленной установки.

Недостатком известного способа является трудоемкость и продолжительность технологического процесса выделения ДНК, наличие двух этапов обработки ультразвуком в вертикальной герметичной ячейке при непрерывном прокачивании раствора перистальтическим насосом, что приводит к значительному снижению производительности процесса и усложнению его масштабирования, а также использование больших количеств необходимых реагентов, в том числе этилового спирта.

Целью заявленного изобретения является разработка способа получения ДНК из молок лососевых рыб, отличающегося увеличением выхода готовой продукции с более высоким содержанием ДНК, снижению стоимости продукта за счет уменьшения количества стадий технологического процесса и возможности его масштабирования за счет использования типового промышленного оборудования.

Для осуществления поставленной задачи производили размораживание сырья из молок лососевых рыб, его измельчение, гидролиз протеолитическим ферментом трипсином, отделение балластных белков и липидов методом центрифугирования, фильтрацию полученной смеси через бельтинг-ткань, лиофилизацию или распылительное высушивание раствора ДНК.

Полученный продукт характеризуется следующими показателями:

внешний вид - аморфный порошок;

цвет - от белого до светло-коричневого;

запах - свойственный данному продукту с рыбным оттенком;

массовая доля влаги, не более - 8%;

массовая доля основного вещества (ДНК), не менее - 65%.

Идентификацию состава получаемого готового продукта и содержание в нем ДНК определяли спектрофотометрическим методом.

Способ осуществляют следующим образом:

Пример 1. Получение ДНК при оптимальном соотношении исходного сырья и трипсина.

40 кг дефростированных молок лососевых рыб измельчают на коллоидной мельнице, обрабатывают водным раствором ферментного препарата трипсина при следующем соотношении компонентов (масс.%): молоки лососевых рыб: вода: трипсин, как 40:59,88:0,12 в течение 3 часов при 45°С.

Водородный показатель рН полученной реакционной смеси (измельченные молоки лососевых рыб и вода) соответствовал оптимуму действия трипсина (рН 8-9)

Полученный гидролизат, для удаления балластных белков и липидов, центрифугируют на проточной центрифуге (15000об./мин.), фильтруют через бельтинг-ткань и подвергают лиофильной или распылительной сушке.

Выход готовой продукции составляет 16,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65%.

Пример 2. Получение ДНК при минимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с минимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,96:0,04.

Выход готовой продукции составляет 14,0-16,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 64,0%.

Пример 3. Получение ДНК при максимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с максимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,8:0,2.

Выход готовой продукции составляет 17,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65,0%.

Пример 4. Получение ДНК при нижеминимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с нижеминимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,98:0,02.

Выход готовой продукции составляет 10,0-14,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 62,0%.

Пример 5. Получение ДНК при вышемаксимальном количественном соотношении исходного сырья и трипсина осуществляется аналогично примеру 1, только с вышемаксимальным количественным соотношением компонентов, а именно молоки лососевых рыб: вода: трипсин, как 40:59,78:0,22.

Выход готовой продукции составляет 17,0-18,0% от количества используемого сырья, при содержании ДНК в готовой продукции не менее 65,0%.

Сравнительные данные по выходу готовой продукции и содержанию в ней основного вещества (ДНК) в зависимости от соотношения компонентов реакционной смеси (молоки лососевых рыб: вода: трипсин) приведены в таблице.

Номер примера Соотношение компонентов реакционной смеси (молоки лососевых рыб: вода: трипсин) Выход готовой продукции, %, не менее Содержание ДНК в готовой продукции, %, не менее
1. 40:59,88:0,12 16,0-18,0 65,0
2. 40:59,96:0,04 14,0-16,0 64,0
3. 40:59,8:0,20 17,0-18,0 65,0
4. 40:59,98:0,02 10,0-14,0 62,0
5. 40:59,78:0,22 17,0-18,0 65,0

Таким образом, увеличение добавления фермента трипсина свыше 0,22 масс.% не приводит к увеличению выхода готовой продукции и содержанию в ней основного вещества и, следовательно, экономически нецелесообразно.

Источники информации, приятные во внимание при экспертизе.

1. Патент RU №2041885 С1, C07H 21/04, C12N 15/10, 20.08.1995

2. Патент RU №2232768 С2, C07H 21/04, 20.07.2004

3. Патент RU №2122856 С1, A61K 35/60, 10.12.1998

4. Патент RU №2017496, A61K 35/60, C07H 21/04, 15.08.1998

5. Патент RU №2005724 C1, C07H 21/04, C12P 19/34, C12M 3/00,

15.01.1994 (прототип)

Способ получения ДНК из молок лососевых рыб, включающий размораживание, измельчение используемого сырья, обработку его водным раствором трипсина с последующим центрифугированием полученного гидролизата, фильтрацией через бельтинг-ткань, лиофильным или распылительным высушиванием, при этом обработку водным раствором трипсина проводят в течение 3 ч при 45°С при содержании компонентов, мас.%: молоки лососевых рыб 40,0, трипсин 0,02-0,22, вода остальное.

edrid.ru

Способ выделения днк из молок осетровых рыб (его варианты)

 

Изобретение относится к медицине и может быть использовано для промышленного получения натриевой соли ДНК для фармакологии. Сущность изобретения состоит в том, что молоки осетровых рыб гомогенизируют, депротеинизацию ДНК осуществляют непосредственно в гомогенате, смесь обрабатывают раствором хлористого натрия при 55-60°С, затем обрабатывают кизельгуром, концентрируют на электродиализной установке либо в мембранном аппарате и озвучивают. ДНК из раствора осаждают спиртом и высушивают в сушильном шкафу при температуре 40°С. 1 з.п. ф-лы.

Изобретение относится к медицине и может быть использовано для промышленного получения натриевой соли ДНК для фармакологии.

Известен способ получения ДНК из молок осетровых рыб путем гомогенизации молок, промывания их физраствором, депротеинизации комплекса ДНК-белок протосубтилином; выделенным из Bacillus subdilis (авт.св. СССР N 780444, С 07 Н 21/04). Известен также способ получения ДНК из молок осетровых рыб, заключающийся в том, что гомогенизацию молок проводят в стандартном цитратно-солевом буфере (ССЦ): 0,87% хлорида натрия, 0,54% цитрата натрия, центрифугируют, депротеинизацию проводят путем прогревания натрия (конечная концентрация 0,61% ). Затем к суспензии добавляют NaCl и цитрат натрия до конечных концентраций 14,6% и 24% соответственно, и прогревают в течение 1-5 ч при 60оС. Для отделения белков раствор после охлаждения пропускают через колонку с кизельгуром, получая на выходе колонки раствор ДНК (Хим.фарм. журнал, 1982, N 7, стр. 835-838). Известен также способ получения ДНК из молок осетровых рыб, заключающийся в том, что молоки гомогенизируют в стандартном цитратно-солевом буфере клеточные ядра собирают центрифугированием, гомогенизируют и проводят депротеинизацию раствором додецилсульфата натрия при температуре около 55оС. Охлажденную смесь интенсивно перемешивают с кизельгуром (15,5%) и отфильтровывают. Целевую ДНК высаживают спиртом в соотношении 1:1. Высокополимерную ДНК растворяют и озвучивают на магнитострикторе, фильтруют и стерильно разливают по флаконам, получая субстанцию 0,6% в 1/10 растворе ССЦ (авт.св. СССР N 1410494, C 07 H 21/04, 1986). Предлагаемый способ заключается в том, что молоки осетровых рыб гомогенизируют в стандартном растворе цитратно-солевого буфера (ССЦ), имеющего состав: хлорид натрия 0,87% натрия цитрат 0,54% Гомогенат прогревают при температуре 55-60оС в присутствии додецилсульфата натрия (конечная концентрация 0,6% ) в течение 1,5 ч. К смеси затем добавляют раствор хлористого натрия до конечной концентрации 14,6% и прогревают 1,5 ч при 55-60оС. Полученную смесь обрабатывают кизельгуром и фильтруют. Полученный раствор ДНК пропускают через камеры электродиализной и/или ультрафильтрационной установок. Полученный раствор обрабатывают ультразвуком, фильтруют, при необходимости концентрируют, осаждают спиртом, осадок промывают 96% спиртом, высушивают в сушильном шкафу при температуре 40оС. Заявленный способ позволяет получить сухой порошок ДНК. При этом выделенная ДНК имеет следующую характеристику: Молекуляр- (3,0-5,0)105 Дальтон ная масса Гипорхромный не менее 37% эффект Изобретение иллюстрируется следующими примерами. П р и м е р 1. 1,2 кг свежезамороженных молок осетра измельчают и гомогенизируют в 2 л цитратно-солевого раствора, состоящего из 0,15 М хлористого натрия и 0,0021 М цитрата натрия, при комнатной температуре. Полученный гомогенат заливают в реактор, где находится 34 л цитратно-солевого раствора. Затем добавляют 4 л 6%-ного раствора додецилсульфата натрия в 45%-ном растворе ректификата этилового спирта (240 г в 4 л 45% спирта). Полученную реакционную массу нагревают в течение 1-1,5 ч до 60-62оС и выдерживают при этой температуре 1,5 ч при перемешивании якорной мешалкой. После чего, в раствор добавляют 40 л 5 м раствора хлористого натрия и перемешивают в течение 1,5 ч. Затем полученную реакционную массу охлаждают до 12-16оС, перемешивают с кизельгуром в соотношении 10: 1 высокооборотной мешалкой и фильтруют на нутч-фильтре. Полученный фильтрат высокополимерной ДНК порциями в количестве 2,5 л подвергают электродиализному концентрированию в многокамерном аппарате-электродиализаторе, фильтр-прессного типа, состоящего из чередующихся мембран типа МА-40 и МК-40 с промежуточными рамками из паронита и сепараторами-турбулизаторами. Катодом служит пластина из нержавеющей стали марки Х18Н10Т с рабочей поверхностью 4 дм2, анодом платинированный титан с той же поверхностью. Электродиализатор состоял из 7 камер "обессоливания" и 8 камер "концентрирования", а также двух электродных камер. Рабочая поверхность каждой мембраны 4 дм2. Реакционную массу высокополимерной ДНК насосом прокачивают через камеры "обессоливания" электродиализатора с линейной скоростью 2,3 см/с, одновременно через камеры "концентрирования" насосом прокачивают 0,5%-ный раствор хлористого натрия, а через электродные камеры водопроводную воду. При температуре 15-20оС через электродиализатор пропускают постоянный ток, сила которого соответствует плотности тока 1,5 А/дм2. В ходе электродиализа поддерживают рН раствора в интервале 6,5-7,5 добавлением разбавленной соляной кислоты (1:3). Поддержание температуры в процессе электродиализа осуществляют подачей захоложенной воды в змеевики промежуточных емкостей. В процессе электродиализного концентрирования получают 1,2 л высокополимерной ДНК. Продолжительность процесса составляет 4,0 часа, удельная производительность аппарата 1,0 л/м2ч, а энергоемкость процесса 216,0 Вт ч/л. При этом выход по току составляет 70,0% Сконцентрированный раствор высокополимерной ДНК заливают в модуль магнитостриктора и подвергают ультразвуковой обработке в течение 45 мин. после чего фильтруют через миллипоровый фильтр и концентрируют в 3 раза на установке "БИОКОН". Концентрат высаживают спиртом в соотношении 1:2. Осадок собирают центрифугированием, промывают 96% спиртом и высушивают в сушильном шкафу при температуре 40оС. Получают сухой порошок натриевой соли ДНК. П р и м е р 2. 1,2 кг свежезамороженных молок осетра измельчают и гомогенизируют в 2 л цитратно-солевого раствора, состоящего из 0,15 М натрия хлорида и 0,0021 М натрия цитрата при комнатной температуре. Полученный гомогенат заливают в реактор, где уже находится 34 л цитратно-солевого раствора. Затем добавляют 4 л 6%-ного раствора натрия додецилсульфата в 45% растворе ректификата этилового спирта (240 г в 4 л 45% спирта). Полученную массу нагревают за 1-1,5 ч до 60-65оС и перемешивают якорной мешалкой в течение 1,5 ч. Затем добавляют 40 л 5 М раствора NaCl и перемешивают в течение 1,5 ч. Затем полученную массу охлаждают до 12-16оС, перемешивают с кизельгуром в соотношении 10:1, на высокооборотной мешалке (миксер) и фильтруют на нутч-фильтре фильтрующий материал: бельтинг, фильтровальная бумага, бязь. Полученный таким образом фильтрат высокополимерной ДНК порциями в количестве 2,0 л подвергают ультрафильтрационному концентрированию в мембранном аппарате плоскорамного типа. Рабочая поверхность мембран составляет 12 дм2. Концентрирование раствора ДНК осуществляют при температуре 20-24оС, линейной скорости раствора 2 см/с и давлении 3,0 кг/см2. Поддержание температуры в процессе ультрафильтрации осуществляют подачей захоложенной воды в змеевик промежуточной емкости. В процессе концентрирования получают 0,4 л раствора высоко- полимерной ДНК. Продолжительность процесса составляет 24 мин, а удельная производительность аппарата 40 л/м2ч. Сконцентрированный раствор высокополимерной ДНК заливают в модуль магнитостриктора и озвучивают в течение 45 мин, после чего фильтруют через миллипоровый фильтр. Фильтрат обрабатывают спиртом, а выпавший осадок собирают центрифугированием, промывают 96%-ным спиртом и высушивают в сушильном шкафу при температуре 40оС. Сухой порошок ДНК растворяют и анализируют. Молекулярную массу ДНК определяли с помощью гельэлектрофореза в 1%-ной агарозе. Концентрацию ДНК определяли спектрофотометрически. Таким образом, предлагаемый способ позволяет получить препарат ДНК, пригодный для целевой фармакологии и медицины.

Формула изобретения

1. Способ выделения ДНК из молок осетровых рыб путем гомогенизации замороженных молок в цитратно-солевом растворе, разбавления гомогената цитратно-солевым раствором, перемешивания гомогената с раствором 6%-ного додецилсульфата, инкубации при 60oС в течение 1,5 ч с последующим добавлением к реакционной смеси 5М раствора хлористого натрия, инкубации и перемешивания смеси в течение 1,5 ч, охлаждения, сорбции белка на кизельгуре, фильтрации и обработки фильтрата, содержащего целевой продукт, 98%-ным этиловым спиртом, отличающийся тем, что реакционную смесь перемешивают с кизельгуром в соотношении 10 1, фильтруют, подвергают электродиализу при 15-20oС, плотности тока 1,5 А/дм2, затем обрабатывают ультразвуком, фильтруют через миллипоровый фильтр, фильтрат осаждают спиртом в соотношении 1:2, а осадок, содержащий целевой продукт, собирают центрифугированием и после обработки спиртом сушат при 40oС. 2. Способ выделения ДНК из молок осетровых рыб путем гомогенизации замороженных молок в цитратно-солевом растворе, разбавления гомогената цитратно-солевым раствором, перемешивания гомогената с раствором 6%-ного додецилсульфата в течение 1,5 ч с последующим добавлением к реакционной смеси 5 М раствора хлористого натрия, инкубации и перемешивания смеси в течение 1,5 ч, охлаждения, сорбции на кизельгуре, фильтрации и обработки фильтрата, содержащего целевой продукт, 98%-ным этиловым спиртом, отличающийся тем, что реакционную смесь перемешивают с кизельгуром в соотношении 10:1, фильтруют, а фильтрат подвергают ультрафильтрационному концентрированию в мембранном аппарате плоскорамного типа при 20-24oС, давлении 3 кг/см2, диализат обрабатывают ультразвуком, фильтруют через миллипоровый фильтр, фильтрат обрабатывают спиртом, а осадок, содержащий целевой продукт, собирают центрифугированием и после обработки спиртом сушат при 40oС.

PC4A - Регистрация договора об уступке патента Российской Федерации на изобретение

Номер и год публикации бюллетеня: 6-2001

(73) Патентообладатель:ООО "Научно-производственное фармацевтическое предприятие "ПОЛИДАН" (RU)

Договор № 11437 зарегистрирован 27.10.2000

Извещение опубликовано: 27.02.2001        

MM4A - Досрочное прекращение действия патента СССР или патента Российской Федерации на изобретение из-за неуплаты в установленный срок пошлины за поддержание патента в силе

Дата прекращения действия патента: 25.05.2007

Извещение опубликовано: 10.09.2008        БИ: 25/2008

www.findpatent.ru

Биологический маркер для определения породы рыб, набор и способ определения породной принадлежности рыб

Изобретение относится к биотехнологии и рыбоводству. Предложен способ определения породной принадлежности рыб с использованием полиморфных маркеров. Способ предусматривает сбор образца крови, выделение ДНК и исследование геномной ДНК с помощью ПЦР. При осуществлении способа используют полиморфные маркеры ДНК разного размера или длины. Визуализацию ДНК проводят при электрофорезе в акриламидном или агарозном геле. Предложены также биологические маркеры и набор для осуществления такого способа. 3 н. и 3 з.п. ф-лы, 2 ил., 2 табл.

 

Изобретение относится к биотехнологии, в частности генетическим исследованиям, к области, связанной с породной идентификацией рыб и их гибридов, а также для прижизненного генетического мониторинга природных и искусственных популяций рыб путем анализа полиморфизма дезоксирибонуклеиновой кислоты.

Известен способ идентификации рыб и их гибридов, в котором в качестве экстракта белков используют слизь, взятую путем соскоба с наружной поверхности тела, и используют гели из полиакриламида, содержащего 4-метилумбеллиферилацетат, а электрофорез и сканирование проводят одновременно (а.с. СССР №1611303, БИ №45, 1990).

Известен способ определения родства живых организмов, включающий выделение ДНК, обработку рестрикционными эндонуклеазами, электрофоретическое фракционирование фрагментов ДНК, перенос ДНК из геля, молекулярную гибридизацию ДНК из живого организма (а.с. СССР №1552642, 1994).

Известен способ селективной амплификации ДНК, олигонуклеотид и набор для селективной амплификации (Патент РФ №2182176, 1992).

Недостатком известных способов является непригодность их для породной идентификации рыб.

Наиболее близким к предлагаемому способу определения пород карповых рыб и биологического маркера для их характеристики является способ подбора особей русского осетра ACIPENCER guldensatdti в аквакультуре, включающий свенс-анализ митохондриальной ДНК в области D-петли методом ПЦР-амплификации, в которой в процессе анализа используется прямой (OS1) и обратный (OS2) праймеры, а для воспроизводства подбирают особей, различающихся по длине ПЦР-продуктов мтДНК (патент РФ №2202178, 2001).

Недостатками этого известного способа является невозможность определения породной принадлежности рыб, отсутствие праймеров и набора для идентификации и паспортизации карповых рыб, невозможность создания генетического паспорта породы рыб.

Задачей предлагаемого изобретения является определение породной принадлежности и установление происхождения распространенных и практически значимых одомашненных форм различных рыб, в том числе из семейства карповых (Cyprinidae).

В результате использования предлагаемого биологического маркера для определения породы рыб, набора и способа идентификации и паспортизации пород рыб появляется возможность создания генетического паспорта породы и повышение эффективности идентификации в генетико-селекционных мероприятиях, связанных с разведением рыб.

Вышеуказанный результат достигается тем, что биологический маркер, содержащий полиморфную ДНК и характеризующий породную принадлежность, происхождение распространенных и практически значимых природных и одомашненных форм рыб семейства карповых и представляющий собой нуклеотидную последовательность из группы 5 пар праймеров следующего состава

PR-4F TCCAAGTCAGTTTAATCACCG
R GGGAAGCGTTGACAACAAGC
PR-10F CTGCAGGGTGCAGGAATAGAC
R GGCTGAACAGGAACAAGAGGC
PR-19F GAATCCTCCCCATCATGCAAAC
R GCACAAACTCCACATTGTGCC
PR-24F GCTCCAGATTGCACATTATAG
R CTACACACACGCAGAGCCTTTC
PR-26F CCCTGAGATAGAAACCACTG
R CACCATGCTTGGATGCAAAAG

Результат достигается также тем, что используют набор для определения породной принадлежности рыб, содержащий биологический маркер, реакционную смесь, состоящую из 60 мМ трис-HCl, 10 мМ сульфата аммония, 0,1% TWEEN 20, по 100 мкМ каждого dNTP, 0,5 мкМ MgCl2, 0,9 единиц Taq-полимеразы и эталонные ДНК для каждой породы.

В способе определения породной принадлежности рыб семейства карповых, включающем сбор образца крови, выделение ДНК из него, исследование геномной ДНК с помощью ПЦР, ПЦР-анализ проводят используя предлагаемый набор, получают полиморфные маркеры ДНК разного размера, визуализируют эти маркерные ДНК с помощью электрофореза в акриламидном или агарозном геле, затем для типирования выявленных в изученной группе аллелей проводят сравнение генетического разнообразия определяемой и контрольной группы образцов амплифицируемой ДНК и по отсутствию или присутствию в исследуемой группе определенных единичных породоспецифических аллелей или аллельных сочетаний определяют породную принадлежность.

Таблица 1.Распределение полиморфных маркеров, выявляемое в исследованных породах карпа и сазана при использовании 5 пар праймеров
ПородаАллели локуса PRL 4Аллели локуса PRL 24Аллели локуса PRL 19Аллели локуса PRL 26Аллели локуса PRL 10
Амурский сазан1, 2, 7, 9, 10, 11, 12, 14*,1, 2, 5, 11, 9*, 14, 15, 16*.1, 2, 3, 4, 5, 7, 8, 13*, 14*.3, 4, 5, 8, 9, 11*, 13*, 14*.1, 2, 3.
Алтайский сазан1, 7, 8, 9, 10, 12, 13*3, 5, 7, 8, 10, 11, 14*, 15*, 17*, 18*.1, 2, 3, 4, 6, 7, 8.1, 3, 4, 5, 6, 8, 9*, 11*, 12*, 13*, 14*.1, 2, 4, 5, 6, 9*, 10*, 11*.
Ангелинский карп3, 4, 5, 7, 11, 15*5, 7, 10, 11, 12*, 15*.1, 2, 3, 5, 8, 12, 16*, 17*.1*, 2*, 3, 4, 5, 6, 8, 9, 11.1, 2, 4, 6, 7, 8, 11.
Алтайский карп (приобская и чумышская популяция)2, 3, 4, 7, 8, 10, 11, 16*.5, 6, 7, 10*, 11, 15*, 20*.1, 3, 5, 6*, 7*, 11*, 14*, 17*.1, 3, 4, 5, 6, 7, 8, 9, 10.1, 4, 8, 13*, 14*.
Венгерский карп2, 3, 7, 104, 5, 92, 8, 9*, 12*, 17.3, 4, 5, 6, 9, 10.1, 4, 6, 12*.
Ставропольский карп1, 4, 7, 10, 17.3, 5, 6, 10, 11, 14, 15.2, 3, 10, 13.3, 4, 5, 6, 8*, 10*, 13*, 14*.1, 2, 4.
Ропшинский карп1, 6, 9, 12, 18*.3, 5, 9, 10, 11, 12, 13*, 20*.1, 2, 3, 8*, 10*, 13.3, 4, 5, 6, 7, 9, 10, 11, 12.1, 2, 3, 4, 5, 6.
Черепецкий рамчатый карп1, 3, 5, 19*6*, 7*, 9*, 10*.1*, 9*, 13*.1, 2, 3, 4, 5, 7, 9*.1, 4, 7, 8.
Черепецкий чешуйчатый карп2, 7, 10, 20*1, 2, 3, 5, 7.3, 7, 10, 15*.1, 3, 4, 7.1, 4, 6, 7, 8.
Всего аллелей2020171414
* единичные породоспецифичные аллели или набор специфичных аллелей.

При этом для каждой породы и породной группы карповых рыб составляют генетический паспорт, представленный в таблице 1, в которой указано распределение 50-75 полиморфных микросателлитных маркеров, выявленных с помощью 5 пар праймеров (PR 4, 10, 19, 24, 26) по пяти соответствующим локусам (PRL 4, 10, 19, 24, 26), и по которой определяют породу рыб.

Размер амплифицируемых продуктов определяют с помощью маркера молекулярных масс (10 bp Ladder).

Набор контрольных амплификатов содержит образцы амплифицированной ДНК, характерные для каждой из изученных пород карповых рыб, в том числе карпа или сазана.

В способе верификацию породной принадлежности проверяют с помощью многомерного анализа (например, дискриминантного анализа, метода главных компонент и т.п.), в котором в качестве обучающей выборки служит выборка аллелей и аллельных сочетаний одной из набора пород рыб.

Способ генетической идентификации пород рыб, в том числе рыб семейства карповых, в том числе пород карпа и сазана с применением предлагаемых биологических маркеров и набора осуществляют следующим образом.

Осуществляют геномный фингерпринтинг для выявления геномной вариабельности рыб и для идентификации и паспортизации различных пород рыб с использованием метода полимеразной цепной реакции (ПЦР или PCR). В предлагаемом способе получают молекулярно-генетические характеристики пород рыб, в том числе карповых рыб, в том числе наиболее распространенных на территории России пород карпа и сазана, предлагают породоспецифичные маркеры с целью паспортизации пород.

При изучении пород и породных групп рыб выявляют несколько породоспецифичных маркеров, которые в дальнейшем используют в качестве эталона для определения породной принадлежности любой группы рыб. Для этого собирают образцы различных тканей (кровь, слизь, кусочки плавников, мышцы и т.п.), выделяют из них ДНК, проводят амплификацию определенных участков ДНК с определенными праймерами, визуализируют полученную изменчивость с помощью специального электрофоретического разделения амплификатов и специального окрашивания, проводят типирование полученной изменчивости путем сравнения с эталонными образцами.

На заключительном этапе для каждой идентифицируемой группы составляют таблицу-паспорт с указанием распределения 50-70 аллельных вариантов по 5 полиморфным локусам. На основании этой таблицы с высокой вероятностью либо визуально, либо с помощью многомерного статистического анализа определяют принадлежность (или отсутствие принадлежности) исследуемой группы рыб к одной из наиболее распространенных пород.

Для генотипирования породы собирают образцы тканей у 20-30 представителей породы (лучше образцы крови) по следующей методике отбора проб.

Наилучшим материалом для последующего выделения суммарной ДНК являются: кровь (обычно, из хвостовой вены) и фрагменты плавников (грудных, брюшных, анальных или спинного), которые берут прижизненно, стараясь не наносить излишних повреждений донорам биопсийного материала. Используют также половые продукты рыб (овулировавшие яйцеклетки и сперму производителей), фрагменты ястыков и семенников на различных стадиях созревания. В тех случаях, когда существует возможность получения проб от умертвленных «ex tempora» особей, в качестве материала может дополнительно использоваться мышечная ткань, печень и другие внутренние органы, за исключением кишечника.

Для кодирования наиболее часто используемых видов тканей предлагается использовать систему, принятую в Российской Национальной Коллекции эталонных генетических материалов (РНКЭГМ), которая демонстрируется табл.2.

Таблица 2.
Жабры - отдельные жаберные дуги, соскобы жаберных тычинок
Икра - неоплодотворенные овулировавшие или пробойные икринки
Ястык - женские гонады на различных стадиях созревания ооцитов до естественной или гормониндуцированной овуляции
Сперма - текучая семенная жидкость, содержащая зрелые сперматозоиды
Молоки - мужские гонады на различных стадиях сперматогенеза до периода созревания
Плавники - любые, включая хвостовой и жировой. Их фрагменты
Мышцы - любые (красные, белые) скелетные мышцы, мышечная ткань висцерального черепа
Кровь - периферическая (из хвостовой вены), при забое возможно взятие из сердца, аорты
Печень - фрагменты (у маломерных особей целиком с обязательным исключением желчного пузыря)
0Почки - проксимальные отделы
1Селезенка - целиком или частично (крупные особи)
2Мозг - все содержимое нейрокраниума за исключением спинного мозга
3Мотальный препарат - эмбрионы, постэмбрионы, личинки, ранняя молодь. Зафиксированные целиком
4Другое - сердце, глаза, усики, хрящевые, костные ткани, спилы и т.д.

Консервация (фиксация) проб.

Для предотвращения деградации ДНК, полученные пробы помещают в фиксирующий раствор. Как правило, это - 70-96% этиловый спирт (этиловый ректификованный, высшей очистки).

Мышцы, фрагменты плавников, печени, ястыков и семенников перед этанольной фиксацией ножницами, скальпелем или полулезвием безопасной бритвы измельчают до кусочков, размеры которых соответствуют приблизительно 0,5 см3.

Первичную фиксацию осуществляют при соотношении спирт/образец 10/1. Вторичную - в среднем, через трое-четверо суток в соотношении 5/1.

Кровь собирают из хвостовой вены при отрезании хвостового плавника (или шприцом). Капли крови собирают в стерильную пробирку с консервантом (0,5 М ЭДТА, рН 8,0) соотношение крови и консерванта 1:10. Не допускается попадания в пробирки слизи и других посторонних примесей, способствующих образованию в пробирке сгустков.

Образцы, зафиксированные и перезалитые этанолом, могут храниться при комнатной температуре в течение 30 и более суток. Для более продолжительного хранения их следует поместить в свежий спиртовой раствор (не ниже 92%) в соотношении спирт/образец 5/1.

Образцы крови, зафиксированные 0,5 М ЭДТА, хранят в холодильнике в течение 30 суток при низких плюсовых (2-4°С) температурах, но образец не должен подвергаться замораживанию.

После замораживания все образцы хранят в холодильнике при отрицательных (не выше -50°С) температурах без размораживания. Но не дольше 90 суток. Для более продолжительного хранения пригодны кельвинаторы, поддерживающие температуру ниже -50°С, а также жидкоазотные сосуды Дюара.

Выделение и хранение ДНК.

1. Выделение ДНК из крови.

Образцы свежей крови, законсервированные в 0,05 М растворе ЭДТА (рН 8.0), хранят при температуре +4°С. Выделение ядерной ДНК проводили по методу Мэтью (Mathew, 1984). Выделение ДНК заключается в последовательном прохождении следующих фаз: лизис клеток и ядер, депротеинизация ДНК с помощью протеиназы К, фенол-хлороформная депротеинизация, осаждение и растворение ДНК. Для получения более очищенных образцов ДНК проводят дополнительную очистку с помощью набора реагентов DIAtom™ Prep 200 (Москва), основанного на использовании лизирующего реагента с гуанидинтиоционатом, в присутствии которого ДНК сорбируется на сорбенте и отмывается затем раствором Экстра-Гена™.

2. Лизис клеток.

К образцу крови добавляют лизирующий буфер в соотношении 1 объем крови: 30 объемов буфера. Состав лизирующего буфера: 320 мМ сахарозы, 1% тритон Х-100, 5 мМ MgCl2 и 10 мМ трис-HCl (рН 7,6). Смесь инкубируют 1 час 30 минут, затем центрифугируют 15 минут при 4°С (2000 g). Супернатант сливают, а осадок подсушивают в течение 30 минут при комнатной температуре.

3. Суспендирование и лизис ядер.

К полученному осадку добавляют 4 мл буфера (25 мМ ЭДТА и 75 М NaCl). Затем проводят суспендирование ядер резким встряхиванием пробирки в течение 10 минут. К суспензии добавляют 0,4 мл 10% SDS (рН 8,0) и выдерживают в течение 10 минут, периодически плавно перемешивая. По завершению лизиса ядер к суспензии добавляют по каплям протеиназу К до конечной концентрации 50 мкг/мл, осторожно перемешивают и инкубируют смесь 4 часа при 45°С или оставляют на ночь при 37°С.

4. Депротеинизация ДНК.

В пробирку со смесью, содержащей лизированные ядра, добавляют 0,3 мл 5 М ацетата натрия или 0,3 мл 5 М ацетата аммония, или 0,5 мл 3 М перхлората натрия и аккуратно перемешивают. К смеси добавляют равный объем фенола, насыщенного трис-HCl (рН>7,6), плавно перемешивают 5 минут и приливают 5 мл водонасыщенного хлороформа, снова плавно перемешивают 5 минут и центрифугируют при 4°С в течение 20 минут (2000 g). Верхнюю фазу с растворенной ДНК отбирают пипеткой, стараясь не захватывать интерфазу, содержащую белки. Фенол-хлороформная депротеинизация повторяется 2-3 раза до полной очистки раствора ДНК от белков. На следующей стадии к отобранному супернатанту добавляют 10 мл водонасыщенного хлороформа, плавно перемешивают 5 минут и центрифугируют в течение 10 минут (2000 g) и отбирают верхнюю фазу с растворенной в ней ДНК.

5. Осаждение ДНК.

К 1 мл растворенной ДНК приливают 20 мкл 5 М ацетата натрия и осторожно перемешивают. Затем добавляют тройной объем 96° этанола и плавно перемешивают до выпадения ДНК в виде тонких белых нитей или белого осадка. ДНК однократно промывают в 70° этаноле для удаления избытка соли, затем - в 90° этаноле. На следующем этапе спирт сливают, ДНК высушивают на воздухе до полного испарения спирта. Высушенную ДНК растворяют в 100 мкл дистиллированной воды.

6. Дополнительная очистка ДНК

В случае некачественного выделения ДНК из крови препараты ДНК необходимо дополнительно очистить. Один из методов дополнительной очистки состоит в следующем: к 40 мкл растворенной ДНК добавляют 160 мкл лизирующего агента и перемешивают содержимое. После термостатирования в течение 5-7 минут при температуре 65°С смесь центрифугируют и супернатант переносят в чистую пробирку. Далее в супернатант добавляют 8 мкл суспензии сорбента NucleoS™, пробирку помещают на ротатор и перемешивают 10 мин. Смесь центрифугируют 10 с при 5000 g, затем с помощью водоструйного насоса удаляют супернатант, не задевая осадка. К осадку добавляют 80 мкл лизирующего реагента, перемешивают до гомогенного состояния, добавляют 200 мкл солевого буфера и центрифугируют после перемешивания 10 с при 5000 g. Затем удаляют супернатант с помощью водоструйного насоса, не задевая осадка, и добавляют 200 мкл солевого буфера, перемешивают и центрифугируют 10 с при 5000 g. Операцию повторяют три раза. Далее пробирки с осадком высушивают при температуре 65°С 4-5 мин, добавляют 20 мкл раствора Экстрагена, суспендируют содержимое пробирки на вортексе 5-10 с и термостатируют 4-5 мин при 65°С. Затем еще раз суспендируют на вортексе и центрифугируют 1 мин при 10000 g. Супернатант, содержащий очищенную ДНК, переносят в чистую пробирку и хранят при температуре +4°С.

В отдельных случаях для быстроты можно использовать различные наборы для выделения ДНК. Ниже приводим метод выделения ДНК из различных тканей рыб с помощью одного из таких наборов, а именно набора реагентов Diatom™ DNA Ргер200 (Москва).

Набор реагентов Diatom™ DNA Ргер200 основан на использовании Лизирующего реагента с гуанидинтиоционатом, который предназначен для лизиса клеток, солюбилизации клеточного дебриса, а также для денатурации клеточных нуклеаз. В присутствии Лизирующего реагента ДНК эффективно сорбируется на NucleoS™-сорбенте, затем легко отмывается от белков и солей спиртовым раствором. ДНК, элюированная из сорбента раствором ЭкстраГеном Е™ или чистой водой, может напрямую использоваться по назначению.

Продолжительность выделения ДНК из жидких проб составляет 25 минут. Выделение ДНК из сухих пятен или мелкоизмельченного твердого материала может длиться до нескольких часов в зависимости от обрабатываемого материала.

7. Аналитический электрофорез

Для определения концентрации и качества выделенных образцов используют метод электрофореза в агарозном геле. Гель-электрофорез проводится в горизонтальной камере в 1х трис-боратном буфере (ТВЕ), рН 7,5-7,8 (0,089 М трис-бората, 0,089 М борной кислоты и 0,002 М ЭДТА). При внесении ДНК в карманы геля используется буфер для нанесения (ксиленцианол, бромфеноловый синий и глицерин). После электрофореза гель окрашивают в растворе бромистого этидия в течение 5-10 минут или добавляют бромистый этидий непосредственно в гель. Вхождение ДНК в гель осуществляют при 20 V в течение 15-20 минут, далее электрофорез ведут при 60 V в течение 2-3 часов. В качестве маркера концентрации используется ДНК фага λ, внесенная в разных количествах, например 0,5; 1; 2 мкг.

Полимеразная цепная реакция (PCR).

1. Проведение PCR.

Выделенную ДНК используют в качестве матрицы в реакции амплификации.

Амплификацию с единичными праймерами проводят по стандартной методике на термоциклере «MJ Research» (USA), имеющем металлический нагревательный блок на 60 образцов. Реакционная смесь объемом 25 мкл содержит 60 мМ трис-HCl, 10 мМ сульфата аммония, 0,1% TWEEN 20, по 100 мкМ каждого dNTP, 0,5 мкМ MgCl2, 0,1 мкМ каждого праймера, 0,9 единиц Taq-полимеразы и 25-100 нг тотальной ДНК. Для проведения PCR используют пять пар праймеров следующего состава:

PR-4F TCCAAGTCAGTTTAATCACCG
R GGGAAGCGTTGACAACAAGC
PR-10F CTGCAGGGTGCAGGAATAGAC
R GGCTGAACAGGAACAAGAGGC
PR-19F GAATCCTCCCCATCATGCAAAC
R GCACAAACTCCACATTGTGCC
PR-24F GCTCCAGATTGCACATTATAG
R CTACACACACGCAGAGCCTTTC
PR-26F CCCTGAGATAGAAACCACTG
R CACCATGCTTGGATGCAAAAG

Для предотвращения испарения с поверхности раствора во время амплификации в каждую пробирку добавляют каплю (около 15 мкл) минерального масла. Каждый цикл полимеразной реакции состоит из следующих этапов денатурации (94°С, 2 мин), отжига (36°С, 1 мин) и элонгации (72°С, 2 мин). Циклы повторяются 35 раз. Первый цикл предваряли денатурацией в течение 5 минут при температуре 94°С. После окончательной достройки амплифицированной ДНК (72°С, 2 мин) температуру снижают до 4°С.

2. Электрофоретическое разделение продуктов и визуализация ПЦР-продуктов.

Продукты амплификации подвергают аналитическому электрофорезу в 1.5% агарозном геле толщиной 7-10 мм, содержащем бромистый этидий. В качестве маркеров молекулярного веса используется 50 bp Ladder (Fermentas). Вхождение в гель осуществляют при 20 V в течение 20 минут, а разделение фрагментов - в течение 10-20 часов при 40-50 V.

В случае эффективной амплификации продукты амплификации подвергают электрофоретическому разделению в вертикальной камере в 6% ПААГе, содержащем 7% мочевину.

Визуализацию осуществляют путем окрашивания гелей азотнокислым серебром из набора Silver Sequence Staining Kit [Promega, USA] согласно инструкции производителя, с последующим фотографированием цифровым фотоаппаратом Nicon. Размер амплифицируемых продуктов определяют с помощью маркера молекулярных масс (50 bp Ladder).

Затем проводят статистическую обработку результатов и составляют породный генетический паспорт.

Для типирования (определения размера в п.н.) выявленных в изученной группе рыб аллелей необходимо провести обязательное сравнение генетического разнообразия данной и контрольной (эталонной) группы образцов амплифицируемой ДНК. Набор контрольных амплификатов может содержать от 5 до 20 образцов амплификатов, характерных для 5-20 микросателлитных аллелей. Отсутствие или присутствие в исследуемой группе определенных аллелей или аллельных сочетаний позволяет надежно определять породную принадлежность. Верификацию породной принадлежности проводят с помощью различных вариантов многомерного (дискриминантного анализа или метода главных компонент), в котором в качестве обучающей выборки может служить выборка аллелей и аллельных сочетаний одной из 9 ранее изученных пород карпа и сазана. Список пород и породных групп карпа и сазана, которые могут служить обучающей выборкой и для которых известно генетическое разнообразие и породоспецифичные аллели: карп зеркальный и чешуйчатый Ангелинский, карп Венгерский, карп Ропшинский, Черепецкий рамчатый и чешуйчатый карп, ставропольский карп, Алтайский и Амурский сазан.

На фиг.1 представлен набор полиморфных ДНК, выявляемых с помощью праймера PR-10 у различных пород карпа.

На фиг.2 представлен набор полиморфных ДНК, выявляемых с помощью праймера PR-24 у различных пород карпа.

Примеры выполнения предлагаемого способа.

Пример 1. Способ определения породы карпа с помощью праймера PR-10

Из образцов крови, полученных из особей Венгерского карпа, Алтайского карпа, Ангелинского карпа (зеркального и чешуйчатого) и Алтайского сазана, выделяют ДНК способом, указанным выше. На каждой из выделенных ДНК осуществляют ПЦР с одной из пяти пар предлагаемых праймеров, а именно PR-10. Полученные амплификационные продукты визуализируют путем электрофореза в гелях, и после окрашивания гелей серебром идентифицируют по размеру (длине) выявляемые полиморфные маркеры. На фиг.1 представлены полиморфные маркеры для каждой породы Венгерского карпа (дорожки 11-17), Алтайского карпа (дорожки 36-56), Ангелинского зеркального (дорожки 18-25) и чешуйчатого (дорожки 26-35) карпа и Алтайского сазана (дорожки 1-10).

Каждая из этих пород характеризуется определенным набором или сочетанием аллелей, часть из которых представлена в таблице 1. Это распределение служит эталоном при сравнении и идентификации неизвестных пород карповых рыб.

Путем сравнения распределения полиморфных ДНК разной длины среди исследуемых и эталонных образцов определяют породную принадлежность.

Пример 2. Способ определения породы карпа с помощью праймера PR-24.

Из образцов крови, полученных из Чумышской и Приобской популяции Алтайского карпа, Ангелинского чешуйчатого карпа и Ангелинского зеркального карпа, Амурского сазана, выделяют ДНК способом, указанным выше. На каждый из выделенных ДНК осуществляют ПЦР с одной из пяти пар предлагаемых праймеров, а именно PR -10. Полученные амплификационные продукты визуализируют путем электрофореза в гелях, и после окрашивания гелей серебром идентифицируют по размеру (длине) выявляемые полиморфные маркеры. На фиг.2 представлены полиморфные маркеры для каждой породы Чумышской (дорожки 1-10) и Приобской (дорожки 11-20), популяции Алтайского карпа, Ангелинского чешуйчатого карпа (дорожки 21-30), и Ангелинского зеркального карпа (дорожки 31-40), Амурского сазана (дорожки 41-49).

Каждая из этих пород характеризуется определенным набором или сочетанием аллелей, часть из которых представлена в таблице 1. Это распределение служит эталоном при сравнении и идентификации неизвестных пород карповых рыб.

Путем сравнения распределения полиморфных ДНК разной длины среди исследуемых и эталонных образцов определяют породную принадлежность.

Генетический паспорт составляется для каждой известной породы и породной группы и представлен в таблице 1, в которой указано распределение 50-70 полиморфных маркеров по 5 парам праймеров. Аналогичный паспорт можно составить для любой выборки карпа неизвестного происхождения.

1. Биологический маркер, содержащий полиморфную ДНК и характеризующий породную принадлежность, происхождение распространенных и практически значимых природных и одомашненных форм рыб семейства карповых и представляющий собой нуклеотидную последовательность из группы 5 пар праймеров следующего состава:

PR-4F TCCAAGTCAGTTTAATCACCG
R GGGAAGCGTTGACAACAAGC
PR-10F CTGCAGGGTGCAGGAATAGAC
R GGCTGAACAGGAACAAGAGGC
PR-19F GAATCCTCCCCATCATGCAAAC
R GCACAAACTCCACATTGTGCC
PR-24F GCTCCAGATTGCACATTATAG
R CTACACACACGCAGAGCCTTTC
PR-26F CCCTGAGATAGAAACCACTG
R CACCATGCTTGGATGCAAAAG

2. Набор для определения породной принадлежности рыб семейства карповых, содержащий биологический маркер по п.1, реакционную смесь, состоящую из 60 мМ трис-HCl, 10 мМ сульфата аммония, 0,1% TWEEN 20, по 100 мкМ каждого dNTP, 0,5 мкМ MgCl2, 0,9 единиц Taq-полимеразы и эталонные ДНК для каждой породы.

3. Способ паспортизации пород рыб семейства карповых с использованием полиморфных маркеров, включающий сбор образца крови, выделение ДНК из него, исследование геномной ДНК с помощью ПЦР, отличающийся тем, что ПЦР-анализ проводят, используя набор по п.2, получают полиморфные маркеры ДНК разного размера или длины, визуализируют эти ДНК при электрофорезе в акриламидном или агарозном геле, затем для типирования выявленных в изученной группе аллелей проводят сравнение генетического разнообразия определяемой и контрольной группы образцов амплифицируемой ДНК, и по отсутствию или присутствию в исследуемой группе определенных единичных породоспецифических аллелей или аллельных сочетаний определяют породную принадлежность, при этом для каждой породы и породной группы рыб составляют генетический паспорт, представленный в таблице 1, в которой указано распределение 50-75 полиморфных микросателлитных маркеров, выявленных с помощью 5 пар праймеров (PR 4, 10, 19, 24, 26) по пяти соответствующим локусам (PRL 4, 10, 19, 24, 26), и по которой определяют породу рыб.

4. Способ по п.3, отличающийся тем, что размер амплифицируемых продуктов определяют с помощью маркера молекулярных масс (10 bp Ladder).

5. Способ по п.3, отличающийся тем, что набор контрольных амплификатов содержит образцы амплифицированной ДНК, характерные для каждой из изученных пород карповых рыб, в том числе карпа или сазана.

6. Способ по пп.3, 4 и 5, отличающийся тем, что верификацию породной принадлежности проверяют с помощью многомерного анализа, например путем дискриминантного анализа, метода главных компонент, в котором в качестве обучающей выборки служит выборка аллелей и аллельных сочетаний одной из набора пород рыб.

www.findpatent.ru


Смотрите также

 

..:::Новинки:::..

Windows Commander 5.11 Свежая версия.

Новая версия
IrfanView 3.75 (рус)

Обновление текстового редактора TextEd, уже 1.75a

System mechanic 3.7f
Новая версия

Обновление плагинов для WC, смотрим :-)

Весь Winamp
Посетите новый сайт.

WinRaR 3.00
Релиз уже здесь

PowerDesk 4.0 free
Просто - напросто сильный upgrade проводника.

..:::Счетчики:::..